Incidental Mutation 'R1886:Syvn1'
ID209601
Institutional Source Beutler Lab
Gene Symbol Syvn1
Ensembl Gene ENSMUSG00000024807
Gene Namesynovial apoptosis inhibitor 1, synoviolin
Synonyms1200010C09Rik, Hrd1
MMRRC Submission 039907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1886 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6046576-6053712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6049227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 169 (S169P)
Ref Sequence ENSEMBL: ENSMUSP00000121885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007482] [ENSMUST00000025723] [ENSMUST00000129081] [ENSMUST00000134667] [ENSMUST00000138532] [ENSMUST00000156550]
Predicted Effect probably benign
Transcript: ENSMUST00000007482
SMART Domains Protein: ENSMUSP00000007482
Gene: ENSMUSG00000007338

DomainStartEndE-ValueType
Pfam:Img2 82 166 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025723
SMART Domains Protein: ENSMUSP00000025723
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
transmembrane domain 159 181 N/A INTRINSIC
RING 240 278 4.7e-10 SMART
low complexity region 286 357 N/A INTRINSIC
low complexity region 365 426 N/A INTRINSIC
low complexity region 488 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129081
SMART Domains Protein: ENSMUSP00000118698
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134667
AA Change: S169P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114960
Gene: ENSMUSG00000024807
AA Change: S169P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138532
AA Change: S169P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114843
Gene: ENSMUSG00000024807
AA Change: S169P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144328
Predicted Effect possibly damaging
Transcript: ENSMUST00000156550
AA Change: S169P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121885
Gene: ENSMUSG00000024807
AA Change: S169P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184338
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Haploinsufficiency results in embryonic death due to systemic abnormal apoptosis. Mice are viable when only a single copy is inactivated and they exhibit a resistance to collagen-induced arthritis due to enhanced apoptosis of synovial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,801,831 N208S probably benign Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acacb T A 5: 114,218,959 L1317Q probably damaging Het
Acsf3 T C 8: 122,784,002 V293A probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
Ahnak G A 19: 9,015,979 D4876N probably damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Arhgdia T C 11: 120,579,418 D143G probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bcl9 G T 3: 97,215,397 R29S probably benign Het
Bhmt2 T A 13: 93,662,490 K274N probably benign Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cit A G 5: 115,933,486 Y584C probably damaging Het
Crebl2 T C 6: 134,851,096 M77T probably benign Het
Dach2 G A X: 113,298,608 G61D probably benign Het
Ddx4 A T 13: 112,622,665 D237E probably damaging Het
Dgcr8 A G 16: 18,278,354 I490T possibly damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Dnah17 T A 11: 118,108,161 I929F possibly damaging Het
Eif3f A G 7: 108,940,751 T289A probably benign Het
Ercc5 A T 1: 44,175,976 K890* probably null Het
Esrp2 A T 8: 106,133,857 V247E probably damaging Het
Evpl C T 11: 116,227,576 G735E probably damaging Het
Fbxl21 A G 13: 56,527,093 I60V probably benign Het
Frem3 A G 8: 80,613,885 I936V probably benign Het
Fsd1l T C 4: 53,696,984 probably null Het
Gad1-ps T C 10: 99,445,582 noncoding transcript Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm11397 C T 13: 33,404,220 R263C possibly damaging Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gm7102 A G 19: 61,175,698 F100L probably damaging Het
Gmppa T C 1: 75,442,508 V353A probably damaging Het
Hmcn1 T C 1: 150,577,295 E5423G probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Krt12 T C 11: 99,418,576 D286G probably damaging Het
Krt75 A T 15: 101,571,097 M266K probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Lag3 T C 6: 124,909,439 N184D probably damaging Het
Lsm10 C G 4: 126,097,948 D32E probably benign Het
Mettl5 A G 2: 69,880,805 V123A probably damaging Het
Mfrp A G 9: 44,103,488 D274G possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mttp A T 3: 138,092,615 V840D probably damaging Het
Nadk2 A C 15: 9,103,358 N308H possibly damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlk T A 11: 78,586,928 I330F probably damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Olfr498 A T 7: 108,465,740 M139L probably benign Het
Orc2 T C 1: 58,471,088 probably null Het
Orc3 A G 4: 34,584,829 Y459H probably damaging Het
Pah T A 10: 87,528,328 N30K possibly damaging Het
Pcsk4 T C 10: 80,328,960 K74E probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pfkm A G 15: 98,127,746 N547S probably damaging Het
Por A G 5: 135,734,274 E546G probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Prdm1 T A 10: 44,439,758 D794V probably damaging Het
Prdx5 A G 19: 6,908,190 I32T probably benign Het
Prlhr G T 19: 60,467,494 C211* probably null Het
Ripk3 C T 14: 55,788,237 probably null Het
Rmnd5b G A 11: 51,627,638 A137V probably damaging Het
Rwdd2b A T 16: 87,437,125 F72I probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Sept1 A G 7: 127,214,765 probably benign Het
Slc30a10 T A 1: 185,462,864 I291N probably damaging Het
Slc7a9 T G 7: 35,453,402 C20W possibly damaging Het
Slc7a9 G C 7: 35,453,403 A21P probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Sra1 T C 18: 36,668,777 M87V probably benign Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tmem62 A T 2: 120,986,670 I236F probably damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Trpa1 T C 1: 14,889,425 D679G probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc22 T A 4: 106,636,866 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyrp1 T A 4: 80,840,806 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp36 A T 11: 118,272,958 Y255N probably damaging Het
Zfp944 A T 17: 22,339,979 Y96N probably benign Het
Other mutations in Syvn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02004:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02218:Syvn1 APN 19 6050199 missense probably damaging 1.00
IGL02335:Syvn1 APN 19 6050093 critical splice donor site probably null
IGL02385:Syvn1 APN 19 6048540 missense probably damaging 1.00
IGL02700:Syvn1 APN 19 6047943 missense probably benign 0.03
IGL02904:Syvn1 APN 19 6049815 nonsense probably null
R0833:Syvn1 UTSW 19 6052453 missense probably benign 0.04
R2031:Syvn1 UTSW 19 6050530 missense probably damaging 1.00
R4299:Syvn1 UTSW 19 6049921 intron probably benign
R4347:Syvn1 UTSW 19 6049921 intron probably benign
R4422:Syvn1 UTSW 19 6049921 intron probably benign
R4423:Syvn1 UTSW 19 6049921 intron probably benign
R4424:Syvn1 UTSW 19 6049921 intron probably benign
R4425:Syvn1 UTSW 19 6049921 intron probably benign
R4647:Syvn1 UTSW 19 6051474 missense probably benign 0.13
R5960:Syvn1 UTSW 19 6050568 missense probably damaging 1.00
R6388:Syvn1 UTSW 19 6052351 missense probably damaging 0.97
R6940:Syvn1 UTSW 19 6051184 unclassified probably benign
R7728:Syvn1 UTSW 19 6051205 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAAAAGTAGTTCCCAGAGGATTC -3'
(R):5'- AAGTCTATGAGGGTGGCCAG -3'

Sequencing Primer
(F):5'- TCCCAGAGGATTCGGCTTAG -3'
(R):5'- GGACAAGATGGCAGAGGCTCC -3'
Posted On2014-06-30