Incidental Mutation 'R1887:Mga'
ID209618
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 039908-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R1887 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119923617 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 869 (L869Q)
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably damaging
Transcript: ENSMUST00000046717
AA Change: L869Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: L869Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079934
AA Change: L869Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: L869Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110773
AA Change: L790Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: L790Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110774
AA Change: L869Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: L869Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150742
Predicted Effect probably damaging
Transcript: ENSMUST00000156510
AA Change: L869Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: L869Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.1%
  • 10x: 93.2%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
4930544D05Rik A G 11: 70,616,423 E98G probably damaging Het
Abca8a A T 11: 110,089,942 M90K probably damaging Het
Adamts9 A G 6: 92,872,788 probably null Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
AF067061 G T 13: 120,264,068 K89N probably damaging Het
Akr1c18 T A 13: 4,143,288 N126I probably benign Het
Ankmy2 T A 12: 36,170,468 M51K possibly damaging Het
Apc A G 18: 34,272,468 E159G probably damaging Het
Arhgef28 G T 13: 98,145,573 S4R probably damaging Het
Atg2b G A 12: 105,654,092 T784M probably benign Het
Atp11a A G 8: 12,812,324 N59D probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Cacna1h T C 17: 25,376,887 Y1875C probably benign Het
Capza1 A T 3: 104,839,780 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cdcp2 T C 4: 107,102,702 F105L probably damaging Het
Cep152 A T 2: 125,620,305 M58K probably benign Het
Comtd1 A G 14: 21,847,741 L108P probably damaging Het
Cyp2b13 A G 7: 26,088,650 Y401C probably damaging Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Eea1 T A 10: 96,018,211 probably null Het
Fam102a T A 2: 32,560,128 N129K possibly damaging Het
Fam171a1 T C 2: 3,220,343 V157A probably damaging Het
Fam173a C A 17: 25,791,345 probably null Het
Fat3 T A 9: 15,967,061 I3375F probably damaging Het
Fmod A G 1: 134,040,813 E197G possibly damaging Het
Fsd1l T C 4: 53,696,984 probably null Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gpatch1 A T 7: 35,303,388 N232K probably damaging Het
H2-Q4 A G 17: 35,380,137 R128G possibly damaging Het
Hc T C 2: 35,034,611 I435V probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Il23r A T 6: 67,473,801 D231E possibly damaging Het
Kcnt2 T A 1: 140,584,247 S1023T probably damaging Het
Klc2 A G 19: 5,108,612 V618A probably benign Het
Lzts1 T C 8: 69,138,833 D221G probably damaging Het
Mdn1 G C 4: 32,742,540 R3926P probably damaging Het
Med24 A G 11: 98,718,816 probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mrvi1 A G 7: 110,924,533 probably null Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlrp5 T A 7: 23,417,484 V211D probably damaging Het
Nr1h4 A T 10: 89,454,867 M433K possibly damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr1054 A G 2: 86,333,273 F28L possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pik3cd T A 4: 149,652,634 I902F probably damaging Het
Pip5kl1 A G 2: 32,578,505 T198A probably damaging Het
Prkdc T C 16: 15,829,635 V3641A probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Rpl37 C T 15: 5,118,590 T83M possibly damaging Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Serinc5 A T 13: 92,701,706 D340V possibly damaging Het
Stambpl1 A G 19: 34,236,408 I346V probably benign Het
Syna G A 5: 134,559,252 S281L probably benign Het
Tet2 T C 3: 133,487,333 T447A possibly damaging Het
Tgfbr3 A G 5: 107,137,008 F592L probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Ttc6 T A 12: 57,673,258 S872T probably benign Het
Ttc7b C T 12: 100,415,130 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr4 T C 4: 139,455,560 L419P probably damaging Het
Ush2a C A 1: 188,399,980 Q800K probably benign Het
Vmn2r115 T C 17: 23,346,033 I298T possibly damaging Het
Vmn2r28 T C 7: 5,488,289 T320A possibly damaging Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
R7921:Mga UTSW 2 119919678 missense probably damaging 1.00
R8165:Mga UTSW 2 119947238 missense probably benign 0.12
R8226:Mga UTSW 2 119960385 missense probably benign 0.33
R8305:Mga UTSW 2 119946319 missense possibly damaging 0.77
R8309:Mga UTSW 2 119960930 missense probably damaging 1.00
R8363:Mga UTSW 2 119963926 missense probably benign 0.43
R8388:Mga UTSW 2 119964081 missense probably benign 0.00
R8524:Mga UTSW 2 119941516 missense probably damaging 0.97
R8693:Mga UTSW 2 119963926 missense possibly damaging 0.65
R8916:Mga UTSW 2 119958338 missense possibly damaging 0.92
R8936:Mga UTSW 2 119964228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAGAGCTAAGACCCTTCAAG -3'
(R):5'- TCTGCTTTGGTGAAACAGGG -3'

Sequencing Primer
(F):5'- TCTAGGTGGAAATTCAGAGGCTTCAC -3'
(R):5'- CTGCTTTGGTGAAACAGGGTATGG -3'
Posted On2014-06-30