Incidental Mutation 'R0119:Podn'
ID20964
Institutional Source Beutler Lab
Gene Symbol Podn
Ensembl Gene ENSMUSG00000028600
Gene Namepodocan
SynonymsSLRR5A
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location108014791-108096445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108021594 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 359 (L359I)
Ref Sequence ENSEMBL: ENSMUSP00000102320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000146851]
Predicted Effect probably damaging
Transcript: ENSMUST00000044248
AA Change: L359I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600
AA Change: L359I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106708
AA Change: L359I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600
AA Change: L359I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106709
AA Change: L359I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600
AA Change: L359I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130026
SMART Domains Protein: ENSMUSP00000123184
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 27 49 1.53e2 SMART
LRR_TYP 50 73 7.37e-4 SMART
LRR 95 120 1.66e1 SMART
LRR 121 139 3.09e2 SMART
low complexity region 188 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145491
Predicted Effect probably damaging
Transcript: ENSMUST00000146851
AA Change: L214I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600
AA Change: L214I

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Meta Mutation Damage Score 0.5917 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the small leucine-rich repeat protein family and contains an amino terminal CX3CXCX7C cysteine-rich cluster followed by a leucine-rich repeat domain. Studies suggest that this protein could function to inhibit smooth muscle cell proliferation and migration following arterial injury. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Podn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Podn APN 4 108022174 missense probably damaging 1.00
IGL01569:Podn APN 4 108024299 missense probably damaging 1.00
IGL02950:Podn APN 4 108017851 missense possibly damaging 0.65
R0196:Podn UTSW 4 108021498 missense probably damaging 1.00
R0499:Podn UTSW 4 108021594 missense probably damaging 1.00
R1539:Podn UTSW 4 108021567 missense probably damaging 1.00
R1705:Podn UTSW 4 108017858 missense probably benign 0.24
R2018:Podn UTSW 4 108023373 missense probably damaging 1.00
R2120:Podn UTSW 4 108023361 missense probably damaging 1.00
R2156:Podn UTSW 4 108021695 missense probably damaging 1.00
R2170:Podn UTSW 4 108022533 missense probably damaging 1.00
R2200:Podn UTSW 4 108022590 missense probably damaging 0.99
R2384:Podn UTSW 4 108022072 missense probably damaging 1.00
R4285:Podn UTSW 4 108021696 missense possibly damaging 0.69
R4606:Podn UTSW 4 108017867 missense probably benign 0.07
R5051:Podn UTSW 4 108014846 missense probably benign 0.15
R5945:Podn UTSW 4 108021713 missense possibly damaging 0.88
R6317:Podn UTSW 4 108027160 missense probably damaging 0.99
R6366:Podn UTSW 4 108018804 missense possibly damaging 0.95
R6830:Podn UTSW 4 108021417 missense possibly damaging 0.96
R6983:Podn UTSW 4 108024273 splice site probably null
R7325:Podn UTSW 4 108017702 splice site probably null
R7456:Podn UTSW 4 108017805 missense probably benign 0.05
R7516:Podn UTSW 4 108022124 missense probably damaging 1.00
X0004:Podn UTSW 4 108021567 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ACGGTTGCCAGACAAGTCAAGTG -3'
(R):5'- TGTCCAGCAACAACCTGTCGAG -3'

Sequencing Primer
(F):5'- TAGCTTGCGGAAGGCATCTC -3'
(R):5'- ACCTGTCGAGGGTCCCAG -3'
Posted On2013-04-11