Incidental Mutation 'R1887:Gm281'
ID209681
Institutional Source Beutler Lab
Gene Symbol Gm281
Ensembl Gene ENSMUSG00000084902
Gene Namepredicted gene 281
SynonymsLOC238939
MMRRC Submission 039908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1887 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13814618-13914478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13828607 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 718 (Y718D)
Ref Sequence ENSEMBL: ENSMUSP00000121887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144914]
Predicted Effect probably damaging
Transcript: ENSMUST00000144914
AA Change: Y718D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121887
Gene: ENSMUSG00000084902
AA Change: Y718D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 32 127 3.45e-2 SMART
CA 156 230 7.87e-9 SMART
CA 274 352 1.36e-3 SMART
CA 376 470 6.99e-3 SMART
CA 492 563 8.69e-11 SMART
CA 589 683 2.09e-1 SMART
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.1%
  • 10x: 93.2%
  • 20x: 86.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
4930544D05Rik A G 11: 70,616,423 E98G probably damaging Het
Abca8a A T 11: 110,089,942 M90K probably damaging Het
Adamts9 A G 6: 92,872,788 probably null Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
AF067061 G T 13: 120,264,068 K89N probably damaging Het
Akr1c18 T A 13: 4,143,288 N126I probably benign Het
Ankmy2 T A 12: 36,170,468 M51K possibly damaging Het
Apc A G 18: 34,272,468 E159G probably damaging Het
Arhgef28 G T 13: 98,145,573 S4R probably damaging Het
Atg2b G A 12: 105,654,092 T784M probably benign Het
Atp11a A G 8: 12,812,324 N59D probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Cacna1h T C 17: 25,376,887 Y1875C probably benign Het
Capza1 A T 3: 104,839,780 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cdcp2 T C 4: 107,102,702 F105L probably damaging Het
Cep152 A T 2: 125,620,305 M58K probably benign Het
Comtd1 A G 14: 21,847,741 L108P probably damaging Het
Cyp2b13 A G 7: 26,088,650 Y401C probably damaging Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Eea1 T A 10: 96,018,211 probably null Het
Fam102a T A 2: 32,560,128 N129K possibly damaging Het
Fam171a1 T C 2: 3,220,343 V157A probably damaging Het
Fam173a C A 17: 25,791,345 probably null Het
Fat3 T A 9: 15,967,061 I3375F probably damaging Het
Fmod A G 1: 134,040,813 E197G possibly damaging Het
Fsd1l T C 4: 53,696,984 probably null Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gpatch1 A T 7: 35,303,388 N232K probably damaging Het
H2-Q4 A G 17: 35,380,137 R128G possibly damaging Het
Hc T C 2: 35,034,611 I435V probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Il23r A T 6: 67,473,801 D231E possibly damaging Het
Kcnt2 T A 1: 140,584,247 S1023T probably damaging Het
Klc2 A G 19: 5,108,612 V618A probably benign Het
Lzts1 T C 8: 69,138,833 D221G probably damaging Het
Mdn1 G C 4: 32,742,540 R3926P probably damaging Het
Med24 A G 11: 98,718,816 probably benign Het
Mga T A 2: 119,923,617 L869Q probably damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mrvi1 A G 7: 110,924,533 probably null Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlrp5 T A 7: 23,417,484 V211D probably damaging Het
Nr1h4 A T 10: 89,454,867 M433K possibly damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr1054 A G 2: 86,333,273 F28L possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pik3cd T A 4: 149,652,634 I902F probably damaging Het
Pip5kl1 A G 2: 32,578,505 T198A probably damaging Het
Prkdc T C 16: 15,829,635 V3641A probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Rpl37 C T 15: 5,118,590 T83M possibly damaging Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Serinc5 A T 13: 92,701,706 D340V possibly damaging Het
Stambpl1 A G 19: 34,236,408 I346V probably benign Het
Syna G A 5: 134,559,252 S281L probably benign Het
Tet2 T C 3: 133,487,333 T447A possibly damaging Het
Tgfbr3 A G 5: 107,137,008 F592L probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Ttc6 T A 12: 57,673,258 S872T probably benign Het
Ttc7b C T 12: 100,415,130 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr4 T C 4: 139,455,560 L419P probably damaging Het
Ush2a C A 1: 188,399,980 Q800K probably benign Het
Vmn2r115 T C 17: 23,346,033 I298T possibly damaging Het
Vmn2r28 T C 7: 5,488,289 T320A possibly damaging Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Other mutations in Gm281
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Gm281 UTSW 14 13899571 missense probably damaging 0.99
R0842:Gm281 UTSW 14 13856686 missense probably benign 0.16
R1252:Gm281 UTSW 14 13862444 missense probably benign 0.00
R1275:Gm281 UTSW 14 13896949 missense probably damaging 1.00
R1631:Gm281 UTSW 14 13829796 missense probably damaging 0.99
R1831:Gm281 UTSW 14 13899619 missense probably damaging 1.00
R1885:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1886:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1903:Gm281 UTSW 14 13829657 missense possibly damaging 0.94
R1940:Gm281 UTSW 14 13828582 missense probably null 0.95
R2324:Gm281 UTSW 14 13868077 missense probably damaging 1.00
R3923:Gm281 UTSW 14 13865990 nonsense probably null
R4193:Gm281 UTSW 14 13914416 missense probably benign 0.02
R4195:Gm281 UTSW 14 13829772 missense probably benign 0.05
R4370:Gm281 UTSW 14 13862375 missense probably benign 0.03
R4675:Gm281 UTSW 14 13856724 missense probably benign 0.32
R4734:Gm281 UTSW 14 13845292 missense probably benign 0.13
R5387:Gm281 UTSW 14 13914438 start codon destroyed probably null 0.82
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6177:Gm281 UTSW 14 13868002 missense probably benign 0.08
R7051:Gm281 UTSW 14 13828486 missense
R7205:Gm281 UTSW 14 13866032 missense
R7258:Gm281 UTSW 14 13899648 missense
R7833:Gm281 UTSW 14 13896968 splice site probably null
R8309:Gm281 UTSW 14 13814954 nonsense probably null
Z1177:Gm281 UTSW 14 13823754 missense
Z1177:Gm281 UTSW 14 13845421 missense
Predicted Primers PCR Primer
(F):5'- TGTCTCTCTAAAGCACACTTAGG -3'
(R):5'- AGAGTTCGTATCCCATTGTCTGTATC -3'

Sequencing Primer
(F):5'- TCACAGTCAGTTAAGATTACCAAAC -3'
(R):5'- CCCATTGTCTGTATCAAGATGGTGC -3'
Posted On2014-06-30