Incidental Mutation 'R1887:Apc'
ID209693
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission 039908-MU
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R1887 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34272468 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 159 (E159G)
Ref Sequence ENSEMBL: ENSMUSP00000127131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066133] [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably damaging
Transcript: ENSMUST00000066133
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064214
Gene: ENSMUSG00000005871
AA Change: E149G

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 8e-29 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 2.3e-32 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079362
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: E149G

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115781
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: E149G

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170023
Predicted Effect probably damaging
Transcript: ENSMUST00000171187
AA Change: E159G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: E159G

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.1%
  • 10x: 93.2%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
4930544D05Rik A G 11: 70,616,423 E98G probably damaging Het
Abca8a A T 11: 110,089,942 M90K probably damaging Het
Adamts9 A G 6: 92,872,788 probably null Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
AF067061 G T 13: 120,264,068 K89N probably damaging Het
Akr1c18 T A 13: 4,143,288 N126I probably benign Het
Ankmy2 T A 12: 36,170,468 M51K possibly damaging Het
Arhgef28 G T 13: 98,145,573 S4R probably damaging Het
Atg2b G A 12: 105,654,092 T784M probably benign Het
Atp11a A G 8: 12,812,324 N59D probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Cacna1h T C 17: 25,376,887 Y1875C probably benign Het
Capza1 A T 3: 104,839,780 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cdcp2 T C 4: 107,102,702 F105L probably damaging Het
Cep152 A T 2: 125,620,305 M58K probably benign Het
Comtd1 A G 14: 21,847,741 L108P probably damaging Het
Cyp2b13 A G 7: 26,088,650 Y401C probably damaging Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Eea1 T A 10: 96,018,211 probably null Het
Fam102a T A 2: 32,560,128 N129K possibly damaging Het
Fam171a1 T C 2: 3,220,343 V157A probably damaging Het
Fam173a C A 17: 25,791,345 probably null Het
Fat3 T A 9: 15,967,061 I3375F probably damaging Het
Fmod A G 1: 134,040,813 E197G possibly damaging Het
Fsd1l T C 4: 53,696,984 probably null Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gpatch1 A T 7: 35,303,388 N232K probably damaging Het
H2-Q4 A G 17: 35,380,137 R128G possibly damaging Het
Hc T C 2: 35,034,611 I435V probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Il23r A T 6: 67,473,801 D231E possibly damaging Het
Kcnt2 T A 1: 140,584,247 S1023T probably damaging Het
Klc2 A G 19: 5,108,612 V618A probably benign Het
Lzts1 T C 8: 69,138,833 D221G probably damaging Het
Mdn1 G C 4: 32,742,540 R3926P probably damaging Het
Med24 A G 11: 98,718,816 probably benign Het
Mga T A 2: 119,923,617 L869Q probably damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mrvi1 A G 7: 110,924,533 probably null Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlrp5 T A 7: 23,417,484 V211D probably damaging Het
Nr1h4 A T 10: 89,454,867 M433K possibly damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr1054 A G 2: 86,333,273 F28L possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pik3cd T A 4: 149,652,634 I902F probably damaging Het
Pip5kl1 A G 2: 32,578,505 T198A probably damaging Het
Prkdc T C 16: 15,829,635 V3641A probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Rpl37 C T 15: 5,118,590 T83M possibly damaging Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Serinc5 A T 13: 92,701,706 D340V possibly damaging Het
Stambpl1 A G 19: 34,236,408 I346V probably benign Het
Syna G A 5: 134,559,252 S281L probably benign Het
Tet2 T C 3: 133,487,333 T447A possibly damaging Het
Tgfbr3 A G 5: 107,137,008 F592L probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Ttc6 T A 12: 57,673,258 S872T probably benign Het
Ttc7b C T 12: 100,415,130 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr4 T C 4: 139,455,560 L419P probably damaging Het
Ush2a C A 1: 188,399,980 Q800K probably benign Het
Vmn2r115 T C 17: 23,346,033 I298T possibly damaging Het
Vmn2r28 T C 7: 5,488,289 T320A possibly damaging Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7027:Apc UTSW 18 34312076 missense probably damaging 1.00
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
R7534:Apc UTSW 18 34316962 missense probably damaging 1.00
R7685:Apc UTSW 18 34314208 missense probably damaging 1.00
R7814:Apc UTSW 18 34272539 missense probably damaging 0.98
RF046:Apc UTSW 18 34282009 critical splice donor site probably benign
RF063:Apc UTSW 18 34282009 critical splice donor site probably benign
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Z1177:Apc UTSW 18 34314463 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGTGGTTGTAATACCCAAGTGC -3'
(R):5'- GAAGTCAGCCCAGGATACATC -3'

Sequencing Primer
(F):5'- GGTTGTAATACCCAAGTGCTACTTC -3'
(R):5'- GTCAGCCCAGGATACATCAAATTCTG -3'
Posted On2014-06-30