Incidental Mutation 'R1895:Nav1'
ID209707
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135458658 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1211 (W1211R)
Ref Sequence ENSEMBL: ENSMUSP00000067241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably damaging
Transcript: ENSMUST00000040599
AA Change: W1211R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: W1211R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067414
AA Change: W1211R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: W1211R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187311
Predicted Effect unknown
Transcript: ENSMUST00000189252
AA Change: W217R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190130
Predicted Effect unknown
Transcript: ENSMUST00000190298
AA Change: W1154R
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: W1154R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190735
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7361:Nav1 UTSW 1 135452853 missense unknown
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAGTAGGTAGAGCCCCAG -3'
(R):5'- TAGCTAGCCTCTCCCTAAGC -3'

Sequencing Primer
(F):5'- GCCCCAGGATAGCAGACATG -3'
(R):5'- AAGCCTCGCATCTTCTCTAAATC -3'
Posted On2014-06-30