Incidental Mutation 'R1895:Or1n1b'
ID 209712
Institutional Source Beutler Lab
Gene Symbol Or1n1b
Ensembl Gene ENSMUSG00000075382
Gene Name olfactory receptor family 1 subfamily N member 1B
Synonyms GA_x6K02T2NLDC-33585366-33584431, Olfr353, MOR127-3
MMRRC Submission 039915-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.211) question?
Stock # R1895 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36779923-36780858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36780458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000149378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100149] [ENSMUST00000215925] [ENSMUST00000217215]
AlphaFold Q8VGK0
Predicted Effect possibly damaging
Transcript: ENSMUST00000100149
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097726
Gene: ENSMUSG00000075382
AA Change: M134K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-56 PFAM
Pfam:7tm_1 39 288 3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215925
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217215
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6367 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,039,551 (GRCm39) S253P probably damaging Het
Adgrb1 A G 15: 74,412,314 (GRCm39) D431G probably damaging Het
Adgrv1 C T 13: 81,522,368 (GRCm39) C5923Y probably damaging Het
Akr1b10 T A 6: 34,365,805 (GRCm39) I110N probably damaging Het
Apba2 T C 7: 64,394,378 (GRCm39) probably null Het
Arhgef12 G T 9: 42,917,152 (GRCm39) Q396K probably damaging Het
Arpc1b A G 5: 145,059,443 (GRCm39) T56A probably null Het
Atoh1 T C 6: 64,706,443 (GRCm39) V46A probably benign Het
AU015836 T C X: 93,012,985 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Capn13 T C 17: 73,657,520 (GRCm39) E240G possibly damaging Het
Cdh8 T C 8: 100,006,189 (GRCm39) T133A possibly damaging Het
Cep295 T C 9: 15,243,399 (GRCm39) T1686A possibly damaging Het
Col4a3 A T 1: 82,656,829 (GRCm39) K749N unknown Het
Col6a3 T A 1: 90,731,433 (GRCm39) M1000L probably benign Het
Coq8b G A 7: 26,939,299 (GRCm39) V150I possibly damaging Het
Dmxl1 G T 18: 50,088,981 (GRCm39) probably null Het
Dnah10 A G 5: 124,835,494 (GRCm39) D990G probably benign Het
Dpp7 G T 2: 25,243,691 (GRCm39) probably null Het
Eif3l A G 15: 78,973,677 (GRCm39) N364S possibly damaging Het
Epb41l5 T C 1: 119,476,902 (GRCm39) D718G possibly damaging Het
F930017D23Rik G A 10: 43,469,440 (GRCm39) noncoding transcript Het
Fam20a T C 11: 109,564,380 (GRCm39) K458E probably benign Het
Fbxo44 C G 4: 148,240,726 (GRCm39) R220S probably damaging Het
Fut2 A G 7: 45,300,748 (GRCm39) F8S probably damaging Het
Gad2 A T 2: 22,575,440 (GRCm39) T515S probably benign Het
Glmn T C 5: 107,718,110 (GRCm39) D269G probably benign Het
Gpatch4 A G 3: 87,959,409 (GRCm39) Y106C probably damaging Het
Grm3 A G 5: 9,562,123 (GRCm39) W576R probably damaging Het
Hdac7 T C 15: 97,694,767 (GRCm39) D701G probably damaging Het
Hectd2 T A 19: 36,591,860 (GRCm39) I687K probably damaging Het
Hmcn2 T C 2: 31,295,647 (GRCm39) S2619P probably damaging Het
Ilf3 T A 9: 21,316,063 (GRCm39) probably benign Het
Kdm4b T A 17: 56,704,340 (GRCm39) V272E probably damaging Het
Kera A G 10: 97,445,009 (GRCm39) K123E probably benign Het
Kif11 G A 19: 37,375,847 (GRCm39) R220K probably damaging Het
Kmt2c A T 5: 25,520,152 (GRCm39) V1986E probably benign Het
Lrp11 T C 10: 7,499,540 (GRCm39) Y244H probably damaging Het
Lrp1b T A 2: 40,555,159 (GRCm39) D320V unknown Het
Map4k5 A T 12: 69,892,529 (GRCm39) D133E probably damaging Het
Megf11 A T 9: 64,586,558 (GRCm39) D461V probably damaging Het
Muc5b A C 7: 141,411,382 (GRCm39) T1443P unknown Het
Mxi1 G A 19: 53,358,775 (GRCm39) R236H probably benign Het
Nav1 A T 1: 135,386,396 (GRCm39) W1211R probably damaging Het
Ncoa3 T A 2: 165,901,097 (GRCm39) N896K possibly damaging Het
Nmt2 T A 2: 3,323,672 (GRCm39) I355N probably benign Het
Nxpe5 T C 5: 138,249,785 (GRCm39) V525A probably damaging Het
Oas1f A T 5: 120,993,648 (GRCm39) T287S probably benign Het
Or5ae1 T C 7: 84,565,487 (GRCm39) S167P probably benign Het
Or6ae1 T A 7: 139,742,726 (GRCm39) I46F possibly damaging Het
Or7a38 T A 10: 78,752,758 (GRCm39) I28N probably damaging Het
Or8b3 T A 9: 38,314,182 (GRCm39) M1K probably null Het
Pakap T C 4: 57,638,068 (GRCm39) V35A probably benign Het
Panx1 A G 9: 14,918,822 (GRCm39) C346R probably benign Het
Plekha7 T C 7: 115,744,209 (GRCm39) E764G probably damaging Het
Plet1 A G 9: 50,415,652 (GRCm39) probably null Het
Plod2 A G 9: 92,489,188 (GRCm39) S707G probably damaging Het
Plscr4 G A 9: 92,365,889 (GRCm39) V120I probably damaging Het
Pramel31 T A 4: 144,088,435 (GRCm39) V77E probably benign Het
Prob1 T A 18: 35,785,942 (GRCm39) T771S possibly damaging Het
Rasa3 A G 8: 13,681,768 (GRCm39) probably benign Het
Ror2 T C 13: 53,285,885 (GRCm39) I110V probably damaging Het
Sec24d A T 3: 123,147,043 (GRCm39) H667L probably benign Het
Sema3d A G 5: 12,623,810 (GRCm39) Q573R probably damaging Het
Serpinb2 T A 1: 107,452,337 (GRCm39) V305D probably damaging Het
Slc11a2 G A 15: 100,301,775 (GRCm39) R249C probably benign Het
Slc14a1 T C 18: 78,152,912 (GRCm39) I276V possibly damaging Het
Snx19 T A 9: 30,343,620 (GRCm39) N593K probably damaging Het
Ssh2 C G 11: 77,340,571 (GRCm39) D574E probably damaging Het
Stil T C 4: 114,881,072 (GRCm39) S539P probably benign Het
Syt4 T C 18: 31,577,141 (GRCm39) K71R probably damaging Het
Tenm4 A T 7: 96,385,015 (GRCm39) H524L probably damaging Het
Tex30 C T 1: 44,130,564 (GRCm39) G68D probably damaging Het
Tm4sf19 A G 16: 32,226,500 (GRCm39) Y138C probably damaging Het
Tmem43 A T 6: 91,463,891 (GRCm39) I389F probably benign Het
Trpm1 A T 7: 63,873,556 (GRCm39) N488Y probably damaging Het
Tshz1 A T 18: 84,031,558 (GRCm39) L950Q probably damaging Het
Vmn1r16 T C 6: 57,299,885 (GRCm39) I246V probably benign Het
Vmn1r188 T G 13: 22,272,815 (GRCm39) S256R possibly damaging Het
Zfp12 G A 5: 143,231,133 (GRCm39) E487K probably damaging Het
Other mutations in Or1n1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Or1n1b APN 2 36,780,731 (GRCm39) missense probably damaging 1.00
IGL02944:Or1n1b APN 2 36,780,800 (GRCm39) missense possibly damaging 0.83
R0101:Or1n1b UTSW 2 36,780,138 (GRCm39) missense probably damaging 1.00
R0118:Or1n1b UTSW 2 36,780,035 (GRCm39) missense probably benign 0.07
R0276:Or1n1b UTSW 2 36,780,035 (GRCm39) missense probably benign 0.26
R0944:Or1n1b UTSW 2 36,780,698 (GRCm39) missense probably damaging 1.00
R0975:Or1n1b UTSW 2 36,780,562 (GRCm39) missense possibly damaging 0.52
R1946:Or1n1b UTSW 2 36,780,458 (GRCm39) missense possibly damaging 0.92
R2847:Or1n1b UTSW 2 36,780,536 (GRCm39) missense probably damaging 1.00
R4573:Or1n1b UTSW 2 36,780,202 (GRCm39) missense probably damaging 1.00
R4631:Or1n1b UTSW 2 36,780,630 (GRCm39) missense probably benign 0.01
R4647:Or1n1b UTSW 2 36,780,663 (GRCm39) missense probably benign 0.00
R4918:Or1n1b UTSW 2 36,780,344 (GRCm39) missense probably damaging 0.98
R4967:Or1n1b UTSW 2 36,780,719 (GRCm39) missense probably damaging 1.00
R5102:Or1n1b UTSW 2 36,780,056 (GRCm39) missense possibly damaging 0.87
R5188:Or1n1b UTSW 2 36,780,405 (GRCm39) missense probably benign
R5392:Or1n1b UTSW 2 36,780,686 (GRCm39) missense probably benign 0.34
R5608:Or1n1b UTSW 2 36,780,527 (GRCm39) missense probably damaging 1.00
R6527:Or1n1b UTSW 2 36,780,594 (GRCm39) missense probably benign 0.02
R8508:Or1n1b UTSW 2 36,780,366 (GRCm39) missense probably damaging 1.00
R8820:Or1n1b UTSW 2 36,780,622 (GRCm39) missense probably benign 0.01
R9052:Or1n1b UTSW 2 36,780,105 (GRCm39) missense probably damaging 1.00
X0017:Or1n1b UTSW 2 36,779,999 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTACTGTACCTCCAAAGCC -3'
(R):5'- CATCTGCAGTGACCAAGATGTTG -3'

Sequencing Primer
(F):5'- AGAAAGCACTAACTCATTGACATG -3'
(R):5'- GTTTAATGTTCAGACTCAGCGC -3'
Posted On 2014-06-30