Incidental Mutation 'R1895:Olfr353'
ID209712
Institutional Source Beutler Lab
Gene Symbol Olfr353
Ensembl Gene ENSMUSG00000075382
Gene Nameolfactory receptor 353
SynonymsGA_x6K02T2NLDC-33585366-33584431, MOR127-3
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36887293-36892936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36890446 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000149378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100149] [ENSMUST00000215925] [ENSMUST00000217215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100149
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097726
Gene: ENSMUSG00000075382
AA Change: M134K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-56 PFAM
Pfam:7tm_1 39 288 3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215925
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217215
AA Change: M134K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6367 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Olfr353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Olfr353 APN 2 36890719 missense probably damaging 1.00
IGL02944:Olfr353 APN 2 36890788 missense possibly damaging 0.83
R0101:Olfr353 UTSW 2 36890126 missense probably damaging 1.00
R0118:Olfr353 UTSW 2 36890023 missense probably benign 0.07
R0276:Olfr353 UTSW 2 36890023 missense probably benign 0.26
R0944:Olfr353 UTSW 2 36890686 missense probably damaging 1.00
R0975:Olfr353 UTSW 2 36890550 missense possibly damaging 0.52
R1946:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R2847:Olfr353 UTSW 2 36890524 missense probably damaging 1.00
R4573:Olfr353 UTSW 2 36890190 missense probably damaging 1.00
R4631:Olfr353 UTSW 2 36890618 missense probably benign 0.01
R4647:Olfr353 UTSW 2 36890651 missense probably benign 0.00
R4918:Olfr353 UTSW 2 36890332 missense probably damaging 0.98
R4967:Olfr353 UTSW 2 36890707 missense probably damaging 1.00
R5102:Olfr353 UTSW 2 36890044 missense possibly damaging 0.87
R5188:Olfr353 UTSW 2 36890393 missense probably benign
R5392:Olfr353 UTSW 2 36890674 missense probably benign 0.34
R5608:Olfr353 UTSW 2 36890515 missense probably damaging 1.00
R6527:Olfr353 UTSW 2 36890582 missense probably benign 0.02
R8508:Olfr353 UTSW 2 36890354 missense probably damaging 1.00
X0017:Olfr353 UTSW 2 36889987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTACTGTACCTCCAAAGCC -3'
(R):5'- CATCTGCAGTGACCAAGATGTTG -3'

Sequencing Primer
(F):5'- AGAAAGCACTAACTCATTGACATG -3'
(R):5'- GTTTAATGTTCAGACTCAGCGC -3'
Posted On2014-06-30