Incidental Mutation 'R1895:Aasdh'
ID 209728
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 039915-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R1895 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77039551 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: S253P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: S253P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126741
AA Change: S253P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136080
Predicted Effect probably damaging
Transcript: ENSMUST00000146570
AA Change: S253P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154548
Meta Mutation Damage Score 0.5924 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A G 15: 74,412,314 (GRCm39) D431G probably damaging Het
Adgrv1 C T 13: 81,522,368 (GRCm39) C5923Y probably damaging Het
Akr1b10 T A 6: 34,365,805 (GRCm39) I110N probably damaging Het
Apba2 T C 7: 64,394,378 (GRCm39) probably null Het
Arhgef12 G T 9: 42,917,152 (GRCm39) Q396K probably damaging Het
Arpc1b A G 5: 145,059,443 (GRCm39) T56A probably null Het
Atoh1 T C 6: 64,706,443 (GRCm39) V46A probably benign Het
AU015836 T C X: 93,012,985 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Capn13 T C 17: 73,657,520 (GRCm39) E240G possibly damaging Het
Cdh8 T C 8: 100,006,189 (GRCm39) T133A possibly damaging Het
Cep295 T C 9: 15,243,399 (GRCm39) T1686A possibly damaging Het
Col4a3 A T 1: 82,656,829 (GRCm39) K749N unknown Het
Col6a3 T A 1: 90,731,433 (GRCm39) M1000L probably benign Het
Coq8b G A 7: 26,939,299 (GRCm39) V150I possibly damaging Het
Dmxl1 G T 18: 50,088,981 (GRCm39) probably null Het
Dnah10 A G 5: 124,835,494 (GRCm39) D990G probably benign Het
Dpp7 G T 2: 25,243,691 (GRCm39) probably null Het
Eif3l A G 15: 78,973,677 (GRCm39) N364S possibly damaging Het
Epb41l5 T C 1: 119,476,902 (GRCm39) D718G possibly damaging Het
F930017D23Rik G A 10: 43,469,440 (GRCm39) noncoding transcript Het
Fam20a T C 11: 109,564,380 (GRCm39) K458E probably benign Het
Fbxo44 C G 4: 148,240,726 (GRCm39) R220S probably damaging Het
Fut2 A G 7: 45,300,748 (GRCm39) F8S probably damaging Het
Gad2 A T 2: 22,575,440 (GRCm39) T515S probably benign Het
Glmn T C 5: 107,718,110 (GRCm39) D269G probably benign Het
Gpatch4 A G 3: 87,959,409 (GRCm39) Y106C probably damaging Het
Grm3 A G 5: 9,562,123 (GRCm39) W576R probably damaging Het
Hdac7 T C 15: 97,694,767 (GRCm39) D701G probably damaging Het
Hectd2 T A 19: 36,591,860 (GRCm39) I687K probably damaging Het
Hmcn2 T C 2: 31,295,647 (GRCm39) S2619P probably damaging Het
Ilf3 T A 9: 21,316,063 (GRCm39) probably benign Het
Kdm4b T A 17: 56,704,340 (GRCm39) V272E probably damaging Het
Kera A G 10: 97,445,009 (GRCm39) K123E probably benign Het
Kif11 G A 19: 37,375,847 (GRCm39) R220K probably damaging Het
Kmt2c A T 5: 25,520,152 (GRCm39) V1986E probably benign Het
Lrp11 T C 10: 7,499,540 (GRCm39) Y244H probably damaging Het
Lrp1b T A 2: 40,555,159 (GRCm39) D320V unknown Het
Map4k5 A T 12: 69,892,529 (GRCm39) D133E probably damaging Het
Megf11 A T 9: 64,586,558 (GRCm39) D461V probably damaging Het
Muc5b A C 7: 141,411,382 (GRCm39) T1443P unknown Het
Mxi1 G A 19: 53,358,775 (GRCm39) R236H probably benign Het
Nav1 A T 1: 135,386,396 (GRCm39) W1211R probably damaging Het
Ncoa3 T A 2: 165,901,097 (GRCm39) N896K possibly damaging Het
Nmt2 T A 2: 3,323,672 (GRCm39) I355N probably benign Het
Nxpe5 T C 5: 138,249,785 (GRCm39) V525A probably damaging Het
Oas1f A T 5: 120,993,648 (GRCm39) T287S probably benign Het
Or1n1b A T 2: 36,780,458 (GRCm39) M134K possibly damaging Het
Or5ae1 T C 7: 84,565,487 (GRCm39) S167P probably benign Het
Or6ae1 T A 7: 139,742,726 (GRCm39) I46F possibly damaging Het
Or7a38 T A 10: 78,752,758 (GRCm39) I28N probably damaging Het
Or8b3 T A 9: 38,314,182 (GRCm39) M1K probably null Het
Pakap T C 4: 57,638,068 (GRCm39) V35A probably benign Het
Panx1 A G 9: 14,918,822 (GRCm39) C346R probably benign Het
Plekha7 T C 7: 115,744,209 (GRCm39) E764G probably damaging Het
Plet1 A G 9: 50,415,652 (GRCm39) probably null Het
Plod2 A G 9: 92,489,188 (GRCm39) S707G probably damaging Het
Plscr4 G A 9: 92,365,889 (GRCm39) V120I probably damaging Het
Pramel31 T A 4: 144,088,435 (GRCm39) V77E probably benign Het
Prob1 T A 18: 35,785,942 (GRCm39) T771S possibly damaging Het
Rasa3 A G 8: 13,681,768 (GRCm39) probably benign Het
Ror2 T C 13: 53,285,885 (GRCm39) I110V probably damaging Het
Sec24d A T 3: 123,147,043 (GRCm39) H667L probably benign Het
Sema3d A G 5: 12,623,810 (GRCm39) Q573R probably damaging Het
Serpinb2 T A 1: 107,452,337 (GRCm39) V305D probably damaging Het
Slc11a2 G A 15: 100,301,775 (GRCm39) R249C probably benign Het
Slc14a1 T C 18: 78,152,912 (GRCm39) I276V possibly damaging Het
Snx19 T A 9: 30,343,620 (GRCm39) N593K probably damaging Het
Ssh2 C G 11: 77,340,571 (GRCm39) D574E probably damaging Het
Stil T C 4: 114,881,072 (GRCm39) S539P probably benign Het
Syt4 T C 18: 31,577,141 (GRCm39) K71R probably damaging Het
Tenm4 A T 7: 96,385,015 (GRCm39) H524L probably damaging Het
Tex30 C T 1: 44,130,564 (GRCm39) G68D probably damaging Het
Tm4sf19 A G 16: 32,226,500 (GRCm39) Y138C probably damaging Het
Tmem43 A T 6: 91,463,891 (GRCm39) I389F probably benign Het
Trpm1 A T 7: 63,873,556 (GRCm39) N488Y probably damaging Het
Tshz1 A T 18: 84,031,558 (GRCm39) L950Q probably damaging Het
Vmn1r16 T C 6: 57,299,885 (GRCm39) I246V probably benign Het
Vmn1r188 T G 13: 22,272,815 (GRCm39) S256R possibly damaging Het
Zfp12 G A 5: 143,231,133 (GRCm39) E487K probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACTAATGCACTGGGAGGAAC -3'
(R):5'- TCTCCATGATGGCACTGCTG -3'

Sequencing Primer
(F):5'- GAACTACTGAAGTATAAAGGACCCTC -3'
(R):5'- CTGAACCTGGGTCCTTTACAAGAG -3'
Posted On 2014-06-30