Incidental Mutation 'R1895:Oas1f'
ID 209730
Institutional Source Beutler Lab
Gene Symbol Oas1f
Ensembl Gene ENSMUSG00000053765
Gene Name 2'-5' oligoadenylate synthetase 1F
Synonyms
MMRRC Submission 039915-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1895 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 120985432-120996049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120993648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 287 (T287S)
Ref Sequence ENSEMBL: ENSMUSP00000056993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057814]
AlphaFold Q14AZ4
Predicted Effect probably benign
Transcript: ENSMUST00000057814
AA Change: T287S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056993
Gene: ENSMUSG00000053765
AA Change: T287S

DomainStartEndE-ValueType
Pfam:OAS1_C 169 353 4.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175198
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,039,551 (GRCm39) S253P probably damaging Het
Adgrb1 A G 15: 74,412,314 (GRCm39) D431G probably damaging Het
Adgrv1 C T 13: 81,522,368 (GRCm39) C5923Y probably damaging Het
Akr1b10 T A 6: 34,365,805 (GRCm39) I110N probably damaging Het
Apba2 T C 7: 64,394,378 (GRCm39) probably null Het
Arhgef12 G T 9: 42,917,152 (GRCm39) Q396K probably damaging Het
Arpc1b A G 5: 145,059,443 (GRCm39) T56A probably null Het
Atoh1 T C 6: 64,706,443 (GRCm39) V46A probably benign Het
AU015836 T C X: 93,012,985 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Capn13 T C 17: 73,657,520 (GRCm39) E240G possibly damaging Het
Cdh8 T C 8: 100,006,189 (GRCm39) T133A possibly damaging Het
Cep295 T C 9: 15,243,399 (GRCm39) T1686A possibly damaging Het
Col4a3 A T 1: 82,656,829 (GRCm39) K749N unknown Het
Col6a3 T A 1: 90,731,433 (GRCm39) M1000L probably benign Het
Coq8b G A 7: 26,939,299 (GRCm39) V150I possibly damaging Het
Dmxl1 G T 18: 50,088,981 (GRCm39) probably null Het
Dnah10 A G 5: 124,835,494 (GRCm39) D990G probably benign Het
Dpp7 G T 2: 25,243,691 (GRCm39) probably null Het
Eif3l A G 15: 78,973,677 (GRCm39) N364S possibly damaging Het
Epb41l5 T C 1: 119,476,902 (GRCm39) D718G possibly damaging Het
F930017D23Rik G A 10: 43,469,440 (GRCm39) noncoding transcript Het
Fam20a T C 11: 109,564,380 (GRCm39) K458E probably benign Het
Fbxo44 C G 4: 148,240,726 (GRCm39) R220S probably damaging Het
Fut2 A G 7: 45,300,748 (GRCm39) F8S probably damaging Het
Gad2 A T 2: 22,575,440 (GRCm39) T515S probably benign Het
Glmn T C 5: 107,718,110 (GRCm39) D269G probably benign Het
Gpatch4 A G 3: 87,959,409 (GRCm39) Y106C probably damaging Het
Grm3 A G 5: 9,562,123 (GRCm39) W576R probably damaging Het
Hdac7 T C 15: 97,694,767 (GRCm39) D701G probably damaging Het
Hectd2 T A 19: 36,591,860 (GRCm39) I687K probably damaging Het
Hmcn2 T C 2: 31,295,647 (GRCm39) S2619P probably damaging Het
Ilf3 T A 9: 21,316,063 (GRCm39) probably benign Het
Kdm4b T A 17: 56,704,340 (GRCm39) V272E probably damaging Het
Kera A G 10: 97,445,009 (GRCm39) K123E probably benign Het
Kif11 G A 19: 37,375,847 (GRCm39) R220K probably damaging Het
Kmt2c A T 5: 25,520,152 (GRCm39) V1986E probably benign Het
Lrp11 T C 10: 7,499,540 (GRCm39) Y244H probably damaging Het
Lrp1b T A 2: 40,555,159 (GRCm39) D320V unknown Het
Map4k5 A T 12: 69,892,529 (GRCm39) D133E probably damaging Het
Megf11 A T 9: 64,586,558 (GRCm39) D461V probably damaging Het
Muc5b A C 7: 141,411,382 (GRCm39) T1443P unknown Het
Mxi1 G A 19: 53,358,775 (GRCm39) R236H probably benign Het
Nav1 A T 1: 135,386,396 (GRCm39) W1211R probably damaging Het
Ncoa3 T A 2: 165,901,097 (GRCm39) N896K possibly damaging Het
Nmt2 T A 2: 3,323,672 (GRCm39) I355N probably benign Het
Nxpe5 T C 5: 138,249,785 (GRCm39) V525A probably damaging Het
Or1n1b A T 2: 36,780,458 (GRCm39) M134K possibly damaging Het
Or5ae1 T C 7: 84,565,487 (GRCm39) S167P probably benign Het
Or6ae1 T A 7: 139,742,726 (GRCm39) I46F possibly damaging Het
Or7a38 T A 10: 78,752,758 (GRCm39) I28N probably damaging Het
Or8b3 T A 9: 38,314,182 (GRCm39) M1K probably null Het
Pakap T C 4: 57,638,068 (GRCm39) V35A probably benign Het
Panx1 A G 9: 14,918,822 (GRCm39) C346R probably benign Het
Plekha7 T C 7: 115,744,209 (GRCm39) E764G probably damaging Het
Plet1 A G 9: 50,415,652 (GRCm39) probably null Het
Plod2 A G 9: 92,489,188 (GRCm39) S707G probably damaging Het
Plscr4 G A 9: 92,365,889 (GRCm39) V120I probably damaging Het
Pramel31 T A 4: 144,088,435 (GRCm39) V77E probably benign Het
Prob1 T A 18: 35,785,942 (GRCm39) T771S possibly damaging Het
Rasa3 A G 8: 13,681,768 (GRCm39) probably benign Het
Ror2 T C 13: 53,285,885 (GRCm39) I110V probably damaging Het
Sec24d A T 3: 123,147,043 (GRCm39) H667L probably benign Het
Sema3d A G 5: 12,623,810 (GRCm39) Q573R probably damaging Het
Serpinb2 T A 1: 107,452,337 (GRCm39) V305D probably damaging Het
Slc11a2 G A 15: 100,301,775 (GRCm39) R249C probably benign Het
Slc14a1 T C 18: 78,152,912 (GRCm39) I276V possibly damaging Het
Snx19 T A 9: 30,343,620 (GRCm39) N593K probably damaging Het
Ssh2 C G 11: 77,340,571 (GRCm39) D574E probably damaging Het
Stil T C 4: 114,881,072 (GRCm39) S539P probably benign Het
Syt4 T C 18: 31,577,141 (GRCm39) K71R probably damaging Het
Tenm4 A T 7: 96,385,015 (GRCm39) H524L probably damaging Het
Tex30 C T 1: 44,130,564 (GRCm39) G68D probably damaging Het
Tm4sf19 A G 16: 32,226,500 (GRCm39) Y138C probably damaging Het
Tmem43 A T 6: 91,463,891 (GRCm39) I389F probably benign Het
Trpm1 A T 7: 63,873,556 (GRCm39) N488Y probably damaging Het
Tshz1 A T 18: 84,031,558 (GRCm39) L950Q probably damaging Het
Vmn1r16 T C 6: 57,299,885 (GRCm39) I246V probably benign Het
Vmn1r188 T G 13: 22,272,815 (GRCm39) S256R possibly damaging Het
Zfp12 G A 5: 143,231,133 (GRCm39) E487K probably damaging Het
Other mutations in Oas1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02398:Oas1f APN 5 120,989,568 (GRCm39) missense probably benign
R0378:Oas1f UTSW 5 120,994,489 (GRCm39) missense probably damaging 0.99
R1414:Oas1f UTSW 5 120,989,522 (GRCm39) intron probably benign
R1826:Oas1f UTSW 5 120,993,652 (GRCm39) missense probably benign 0.33
R1848:Oas1f UTSW 5 120,993,492 (GRCm39) missense probably damaging 1.00
R1960:Oas1f UTSW 5 120,994,502 (GRCm39) missense possibly damaging 0.54
R2193:Oas1f UTSW 5 120,989,648 (GRCm39) missense probably damaging 1.00
R4622:Oas1f UTSW 5 120,986,390 (GRCm39) missense probably damaging 0.98
R4758:Oas1f UTSW 5 120,985,545 (GRCm39) missense probably damaging 1.00
R5882:Oas1f UTSW 5 120,986,316 (GRCm39) missense probably damaging 0.99
R6515:Oas1f UTSW 5 120,986,497 (GRCm39) missense probably damaging 1.00
R6944:Oas1f UTSW 5 120,986,247 (GRCm39) missense probably benign 0.01
R7980:Oas1f UTSW 5 120,989,538 (GRCm39) missense probably benign 0.16
R8048:Oas1f UTSW 5 120,986,479 (GRCm39) missense possibly damaging 0.91
R8048:Oas1f UTSW 5 120,985,602 (GRCm39) missense probably damaging 1.00
R8921:Oas1f UTSW 5 120,989,556 (GRCm39) missense probably benign 0.20
R9376:Oas1f UTSW 5 120,986,243 (GRCm39) nonsense probably null
R9453:Oas1f UTSW 5 120,993,592 (GRCm39) missense probably damaging 0.99
R9777:Oas1f UTSW 5 120,994,429 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACACCAGAGCCCCATGTTTC -3'
(R):5'- GTCAATCAGGTGACAGCAGGAC -3'

Sequencing Primer
(F):5'- TTCTCAGTGTAAGGAGAAGCTG -3'
(R):5'- CAGGACAGTGCCCAGTACAG -3'
Posted On 2014-06-30