Mutagenetix > Incidental Mutations

Incidental Mutation 'R1895:Arpc1b'

209734

Institutional Source

Beutler Lab

Gene Symbol

Arpc1b

Ensembl Gene

ENSMUSG00000029622

Gene Name

actin related protein 2/3 complex, subunit 1B

Synonyms

SOP2Hs, L72, p41-ARC

MMRRC Submission

039915-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145114215-145130705 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145122633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 56 (T56A)

Ref Sequence

ENSEMBL: ENSMUSP00000122340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000141602] [ENSMUST00000141602] [ENSMUST00000196111]

AlphaFold

Q9WV32

Predicted Effect

probably benign
Transcript: ENSMUST00000085679
AA Change: T56A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622
AA Change: T56A

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	4e-14	BLAST
WD40	41	80	1.21e-7	SMART
WD40	85	124	1.54e0	SMART
WD40	130	170	1.56e-1	SMART
WD40	191	230	7.7e-1	SMART
Blast:WD40	233	271	9e-18	BLAST
WD40	317	358	3.55e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128229

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129033

Predicted Effect

probably benign
Transcript: ENSMUST00000136074

SMART Domains

Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

Domain	Start	End	E-Value	Type
Pfam:WD40	3	29	2.5e-3	PFAM
WD40	77	121	1.79e-1	SMART
WD40	142	181	7.7e-1	SMART
Blast:WD40	184	222	1e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138235

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138900

Predicted Effect

probably benign
Transcript: ENSMUST00000138922

SMART Domains

Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622

Domain	Start	End	E-Value	Type
PDB:2P9U\|C	2	93	4e-43	PDB
SCOP:d1k8kc_	35	93	2e-11	SMART
Blast:WD40	50	87	3e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000141602
AA Change: T56A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622
AA Change: T56A

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	2e-15	BLAST
PDB:2P9U\|C	1	56	2e-33	PDB
SCOP:d1k8kc_	9	56	2e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000141602
AA Change: T56A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622
AA Change: T56A

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	2e-15	BLAST
PDB:2P9U\|C	1	56	2e-33	PDB
SCOP:d1k8kc_	9	56	2e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144375

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196111
AA Change: T56A

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622
AA Change: T56A

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	4e-14	BLAST
WD40	41	80	1.21e-7	SMART
WD40	85	124	1.54e0	SMART
WD40	130	170	1.56e-1	SMART
WD40	191	230	7.7e-1	SMART
Blast:WD40	237	275	2e-16	BLAST
WD40	321	362	3.55e1	SMART

Meta Mutation Damage Score

0.6198

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Arpc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Arpc1b	APN	5	145127869	utr 3 prime	probably benign
IGL01625:Arpc1b	APN	5	145121745	splice site	probably null
IGL01859:Arpc1b	APN	5	145123730	missense	probably damaging	0.98
illusory	UTSW	5	145122567	missense	probably damaging	1.00
FR4304:Arpc1b	UTSW	5	145126791	frame shift	probably null
FR4340:Arpc1b	UTSW	5	145126792	frame shift	probably null
FR4737:Arpc1b	UTSW	5	145126787	frame shift	probably null
R0110:Arpc1b	UTSW	5	145127715	missense	probably damaging	1.00
R0245:Arpc1b	UTSW	5	145126860	missense	probably damaging	1.00
R0469:Arpc1b	UTSW	5	145127715	missense	probably damaging	1.00
R0652:Arpc1b	UTSW	5	145126860	missense	probably damaging	1.00
R0827:Arpc1b	UTSW	5	145125756	missense	probably benign	0.34
R1117:Arpc1b	UTSW	5	145125754	missense	possibly damaging	0.95
R1453:Arpc1b	UTSW	5	145125745	missense	probably damaging	1.00
R1946:Arpc1b	UTSW	5	145122633	missense	probably null	0.99
R2050:Arpc1b	UTSW	5	145125919	missense	probably damaging	1.00
R2112:Arpc1b	UTSW	5	145123769	missense	probably damaging	0.99
R4924:Arpc1b	UTSW	5	145126815	missense	probably benign	0.02
R6534:Arpc1b	UTSW	5	145122567	missense	probably damaging	1.00
R6883:Arpc1b	UTSW	5	145126929	missense	probably benign	0.31
R8523:Arpc1b	UTSW	5	145124682	missense	probably damaging	1.00
R8854:Arpc1b	UTSW	5	145123595	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTCTAGTGGAGAGCATAGGTGG -3'
(R):5'- CTCTCCTGAGCATCTAAGTGC -3'

Sequencing Primer
(F):5'- GCATAGGTGGGCAGGGTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'

Posted On

2014-06-30