Mutagenetix > Incidental Mutation

Incidental Mutation 'R1895:Fut2'

209741

Institutional Source

Beutler Lab

Gene Symbol

Fut2

Ensembl Gene

ENSMUSG00000055978

Gene Name

fucosyltransferase 2

Synonyms

MMRRC Submission

039915-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1895 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

45648591-45666394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45651324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 8 (F8S)

Ref Sequence

ENSEMBL: ENSMUSP00000147471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]

AlphaFold

Q9JL27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069800
AA Change: F8S

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: F8S

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_11	21	338	2.1e-139	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000210620
AA Change: F8S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210988

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211324

Meta Mutation Damage Score

0.2348

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Fut2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02814:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02831:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02982:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03071:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03090:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03126:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03146:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03151:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03179:Fut2	APN	7	45650649	missense	probably benign	0.02
IGL03212:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03213:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03234:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03271:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03372:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03381:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03385:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03392:Fut2	APN	7	45650769	missense	possibly damaging	0.94
PIT4515001:Fut2	UTSW	7	45650466	missense	probably damaging	1.00
R0553:Fut2	UTSW	7	45651274	missense	probably damaging	1.00
R1946:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R2347:Fut2	UTSW	7	45650328	missense	probably damaging	0.99
R3155:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R3156:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R4590:Fut2	UTSW	7	45650946	missense	possibly damaging	0.64
R6311:Fut2	UTSW	7	45650380	missense	possibly damaging	0.46
R6810:Fut2	UTSW	7	45650505	missense	probably damaging	1.00
R6965:Fut2	UTSW	7	45650881	missense	probably damaging	1.00
R8135:Fut2	UTSW	7	45651142	missense	probably damaging	1.00
R9087:Fut2	UTSW	7	45651069	missense	probably damaging	1.00
R9097:Fut2	UTSW	7	45650951	missense	probably benign	0.01
R9462:Fut2	UTSW	7	45651068	missense	probably damaging	1.00
X0066:Fut2	UTSW	7	45650374	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATCGTGAATATGCCCTGCAG -3'
(R):5'- CACAGTTTCCAGCTAGACTAAGC -3'

Sequencing Primer
(F):5'- AATATGCCCTGCAGCTTGG -3'
(R):5'- GCTAGACTAAGCTATGGCATGAAATC -3'

Posted On

2014-06-30