Mutagenetix > Incidental Mutation

Incidental Mutation 'R1895:Trpm1'

209742

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

039915-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64223808 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 488 (N488Y)

Ref Sequence

ENSEMBL: ENSMUSP00000134947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: N604Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: N604Y

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107525
AA Change: N604Y

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: N604Y

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: N488Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: N488Y

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: N488Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206277
AA Change: N604Y

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Meta Mutation Damage Score

0.2787

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCTGTCATTCCCGTATATCATATG -3'
(R):5'- CATGTGAAAGCTAGGAGGCC -3'

Sequencing Primer
(F):5'- TGGTAACAGAATGAACATCGTTG -3'
(R):5'- AAAGCTAGGAGGCCCTGCAC -3'

Posted On

2014-06-30