Mutagenetix > Incidental Mutations

Incidental Mutation 'R1895:Cep295'

209752

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039915-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15332103 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1686 (T1686A)

Ref Sequence

ENSEMBL: ENSMUSP00000123788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066038

Predicted Effect

probably benign
Transcript: ENSMUST00000098979
AA Change: T1686A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: T1686A

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000160946
AA Change: T430A

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: T430A

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: T1686A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: T1686A

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161795
AA Change: T1638A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: T1638A

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Meta Mutation Damage Score

0.0773

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- TTATCTGAGAACCCACTGCAAC -3'
(R):5'- TGTTTCTGTCCAAGGAAATAGAGC -3'

Sequencing Primer
(F):5'- TTAAATTCAGAACATACCTGACTGAC -3'
(R):5'- TGTCCAAGGAAATAGAGCATCCATTC -3'

Posted On

2014-06-30