Mutagenetix > Incidental Mutation

Incidental Mutation 'R1895:Snx19'

209754

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

039915-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30432324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 593 (N593K)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]

AlphaFold

Q6P4T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: N593K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: N593K

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216552

Meta Mutation Damage Score

0.4527

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
R8087:Snx19	UTSW	9	30464402	missense	probably benign
R8211:Snx19	UTSW	9	30437465	missense	probably benign
R8283:Snx19	UTSW	9	30463226	missense	possibly damaging	0.56
R9000:Snx19	UTSW	9	30464323	missense	unknown
R9383:Snx19	UTSW	9	30435900	missense	probably damaging	1.00
R9436:Snx19	UTSW	9	30463306	missense	possibly damaging	0.55
R9782:Snx19	UTSW	9	30428876	missense	probably benign	0.00
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACACGCTACTGTCACCATTG -3'
(R):5'- TCATCACAGCTGTCCAACTC -3'

Sequencing Primer
(F):5'- GCTACTGTCACCATTGAACAACTC -3'
(R):5'- CCGAGACTTCTCAAGAAAACTTGGG -3'

Posted On

2014-06-30