Incidental Mutation 'R1895:Arhgef12'
ID209756
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43005856 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 396 (Q396K)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: Q395K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: Q395K

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: Q396K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: Q396K

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.8537 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAGTCTCCTTGGAGTTTGTC -3'
(R):5'- ATGGGAAATTCTGCTGGCTG -3'

Sequencing Primer
(F):5'- GTCTGCTTATACAGGTCTGAATAGAG -3'
(R):5'- GTGTTCAGTTGGCCTCACAAGTAC -3'
Posted On2014-06-30