Mutagenetix > Incidental Mutations

Incidental Mutation 'R1895:Ssh2'

209765

Institutional Source

Beutler Lab

Gene Symbol

Ssh2

Ensembl Gene

ENSMUSG00000037926

Gene Name

slingshot protein phosphatase 2

Synonyms

SSH-2

MMRRC Submission

039915-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.378) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77216287-77460220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 77449745 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 574 (D574E)

Ref Sequence

ENSEMBL: ENSMUSP00000137933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037912
AA Change: D568E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: D568E

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
Pfam:DEK_C	251	302	3.1e-13	PFAM
DSPc	307	445	2.2e-41	SMART
low complexity region	459	469	N/A	INTRINSIC
low complexity region	871	882	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000181283
AA Change: D574E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: D574E

Domain	Start	End	E-Value	Type
Pfam:DEK_C	256	309	1.7e-18	PFAM
DSPc	313	451	2.2e-41	SMART
low complexity region	465	475	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1376	1391	N/A	INTRINSIC

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Ssh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Ssh2	APN	11	77441926	missense	probably damaging	1.00
IGL01141:Ssh2	APN	11	77449726	missense	probably damaging	1.00
IGL01520:Ssh2	APN	11	77449906	missense	probably damaging	1.00
IGL01803:Ssh2	APN	11	77425330	missense	probably damaging	0.99
IGL01989:Ssh2	APN	11	77453685	missense	possibly damaging	0.79
IGL02322:Ssh2	APN	11	77416413	critical splice acceptor site	probably null
IGL02466:Ssh2	APN	11	77416407	splice site	probably benign
IGL02683:Ssh2	APN	11	77398256	missense	probably damaging	0.99
IGL02706:Ssh2	APN	11	77453406	missense	possibly damaging	0.68
IGL02719:Ssh2	APN	11	77425587	missense	probably damaging	1.00
IGL02721:Ssh2	APN	11	77454725	nonsense	probably null
IGL02732:Ssh2	APN	11	77437776	splice site	probably null
IGL02745:Ssh2	APN	11	77455407	missense	probably damaging	1.00
IGL02993:Ssh2	APN	11	77453544	missense	probably damaging	1.00
IGL03000:Ssh2	APN	11	77421206	splice site	probably benign
IGL03055:Ssh2	UTSW	11	77408195	nonsense	probably null
R0024:Ssh2	UTSW	11	77454966	missense	possibly damaging	0.68
R0374:Ssh2	UTSW	11	77408143	missense	probably damaging	1.00
R0539:Ssh2	UTSW	11	77454794	missense	probably benign	0.11
R0834:Ssh2	UTSW	11	77437633	missense	possibly damaging	0.87
R1714:Ssh2	UTSW	11	77454024	missense	possibly damaging	0.94
R1743:Ssh2	UTSW	11	77437756	missense	probably damaging	1.00
R1889:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R3945:Ssh2	UTSW	11	77454668	missense	possibly damaging	0.93
R3947:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R3948:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R4133:Ssh2	UTSW	11	77421269	missense	probably damaging	1.00
R4256:Ssh2	UTSW	11	77408183	missense	possibly damaging	0.48
R4499:Ssh2	UTSW	11	77393067	nonsense	probably null
R4548:Ssh2	UTSW	11	77450184	missense	probably benign	0.20
R4644:Ssh2	UTSW	11	77449576	missense	possibly damaging	0.46
R4690:Ssh2	UTSW	11	77455205	missense	possibly damaging	0.62
R4788:Ssh2	UTSW	11	77429798	missense	probably damaging	1.00
R4919:Ssh2	UTSW	11	77425320	missense	possibly damaging	0.91
R5014:Ssh2	UTSW	11	77455276	nonsense	probably null
R5380:Ssh2	UTSW	11	77453945	missense	probably benign	0.01
R5574:Ssh2	UTSW	11	77450115	missense	probably benign
R5593:Ssh2	UTSW	11	77421366	missense	probably damaging	0.99
R5739:Ssh2	UTSW	11	77449813	missense	probably damaging	1.00
R6180:Ssh2	UTSW	11	77453465	missense	probably benign	0.43
R6542:Ssh2	UTSW	11	77450150	missense	possibly damaging	0.94
R6713:Ssh2	UTSW	11	77449433	missense	possibly damaging	0.89
R7108:Ssh2	UTSW	11	77454794	missense	probably benign
R7124:Ssh2	UTSW	11	77454338	missense	probably benign	0.00
R7255:Ssh2	UTSW	11	77425593	missense	probably damaging	1.00
R7332:Ssh2	UTSW	11	77453523	missense	possibly damaging	0.48
R7362:Ssh2	UTSW	11	77449650	missense	probably benign	0.01
R7395:Ssh2	UTSW	11	77393073	missense	probably damaging	0.99
R7412:Ssh2	UTSW	11	77450108	missense	probably damaging	0.98
R7493:Ssh2	UTSW	11	77437716	missense	probably benign	0.16
R7686:Ssh2	UTSW	11	77425324	missense	possibly damaging	0.89
R7870:Ssh2	UTSW	11	77453615	missense	probably benign
R7895:Ssh2	UTSW	11	77454626	missense	probably benign	0.41
R7953:Ssh2	UTSW	11	77453615	missense	probably benign
R7978:Ssh2	UTSW	11	77454626	missense	probably benign	0.41
R8030:Ssh2	UTSW	11	77454506	missense	probably benign	0.01
R8065:Ssh2	UTSW	11	77441985	missense	probably damaging	1.00
RF018:Ssh2	UTSW	11	77454054	missense	probably damaging	0.99
X0017:Ssh2	UTSW	11	77441898	missense	probably damaging	1.00
Z1088:Ssh2	UTSW	11	77449495	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGAACCTTGCTGCCATG -3'
(R):5'- TCCAGATCAGGTGACATGGG -3'

Sequencing Primer
(F):5'- ATGCCTACCGTCTTTATGGAAC -3'
(R):5'- ACATGGGGAGGTCTTTCAGTC -3'

Posted On

2014-06-30