Mutagenetix > Incidental Mutations

Incidental Mutation 'R1895:Mxi1'

209784

Institutional Source

Beutler Lab

Gene Symbol

Mxi1

Ensembl Gene

ENSMUSG00000025025

Gene Name

MAX interactor 1, dimerization protein

Synonyms

Mad2, bHLHc11

MMRRC Submission

039915-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R1895 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

53310506-53375810 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53370344 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 236 (R236H)

Ref Sequence

ENSEMBL: ENSMUSP00000003870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003870] [ENSMUST00000025998] [ENSMUST00000086887] [ENSMUST00000111737]

Predicted Effect

probably benign
Transcript: ENSMUST00000003870
AA Change: R236H

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000003870
Gene: ENSMUSG00000025025
AA Change: R236H

Domain	Start	End	E-Value	Type
low complexity region	16	45	N/A	INTRINSIC
HLH	140	192	4.4e-11	SMART
low complexity region	230	252	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000025998
AA Change: R169H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000025998
Gene: ENSMUSG00000025025
AA Change: R169H

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
HLH	73	125	4.4e-11	SMART
low complexity region	163	185	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086887

Predicted Effect

probably benign
Transcript: ENSMUST00000111737
AA Change: R133H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000107366
Gene: ENSMUSG00000025025
AA Change: R133H

Domain	Start	End	E-Value	Type
HLH	37	89	4.4e-11	SMART
low complexity region	127	149	N/A	INTRINSIC

Meta Mutation Damage Score

0.0924

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: This gene encodes a protein containing a helix-loop-helix domain characteristic of transcription factors, which allows heterodimerization and sequence-specific DNA binding. The encoded protein is related to a family of Myc/Max/Mad proteins that are involved in the regulation of several cellular processes. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate Myc function. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show multisystem anomalies including progressive hyperplasia in the spleen and prostate, degenerative changes in the kidney, and increased sensitivity to carcinogens. In addition, mutant embryo fibroblasts are more prone to transformation by the Myc and Ras oncogenes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col4a3	A	T	1: 82,679,108	K749N	unknown	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Mxi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R3691:Mxi1	UTSW	19	53369631	missense	probably damaging	1.00
R3774:Mxi1	UTSW	19	53371729	missense	probably benign	0.18
R3775:Mxi1	UTSW	19	53371729	missense	probably benign	0.18
R3776:Mxi1	UTSW	19	53371729	missense	probably benign	0.18
R4020:Mxi1	UTSW	19	53371729	missense	probably benign	0.18
R4825:Mxi1	UTSW	19	53370338	nonsense	probably null
R4832:Mxi1	UTSW	19	53370314	missense	probably damaging	1.00
R7469:Mxi1	UTSW	19	53371660	missense	probably damaging	1.00
R7480:Mxi1	UTSW	19	53371635	missense	possibly damaging	0.91
R7487:Mxi1	UTSW	19	53371657	missense	probably damaging	1.00
R7891:Mxi1	UTSW	19	53310761	missense	probably benign	0.00
R8236:Mxi1	UTSW	19	53369598	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACTACAGGTGTGAATAAAACATC -3'
(R):5'- ATGTTAGGGTGCACAAAGCCC -3'

Sequencing Primer
(F):5'- CTTCATTTTAGAAACTTGAAGAAGCG -3'
(R):5'- GGGCTCACTCTTCCTAACCTAG -3'

Posted On

2014-06-30