Incidental Mutation 'R1889:Dnmt3b'
Institutional Source Beutler Lab
Gene Symbol Dnmt3b
Ensembl Gene ENSMUSG00000027478
Gene NameDNA methyltransferase 3B
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosomal Location153649450-153687730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153676759 bp
Amino Acid Change Alanine to Glutamic Acid at position 614 (A614E)
Ref Sequence ENSEMBL: ENSMUSP00000105396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056495] [ENSMUST00000072997] [ENSMUST00000081628] [ENSMUST00000088976] [ENSMUST00000103150] [ENSMUST00000103151] [ENSMUST00000109771] [ENSMUST00000109772] [ENSMUST00000109773] [ENSMUST00000109774]
Predicted Effect probably benign
Transcript: ENSMUST00000056495
AA Change: A615E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051830
Gene: ENSMUSG00000027478
AA Change: A615E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072997
AA Change: A614E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072761
Gene: ENSMUSG00000027478
AA Change: A614E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081628
AA Change: A594E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080334
Gene: ENSMUSG00000027478
AA Change: A594E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088976
AA Change: A614E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086370
Gene: ENSMUSG00000027478
AA Change: A614E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103150
AA Change: A594E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099439
Gene: ENSMUSG00000027478
AA Change: A594E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103151
AA Change: A594E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099440
Gene: ENSMUSG00000027478
AA Change: A594E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109771
AA Change: A615E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105393
Gene: ENSMUSG00000027478
AA Change: A615E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109772
AA Change: A614E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105394
Gene: ENSMUSG00000027478
AA Change: A614E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109773
AA Change: A594E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105395
Gene: ENSMUSG00000027478
AA Change: A594E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109774
AA Change: A614E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105396
Gene: ENSMUSG00000027478
AA Change: A614E

low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene results in severe developmental defects and loss of viability. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. There is a pseudogene for this gene located adjacent to this gene in the same region of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation and rostral neural tube defects, and die prenatally. Mutants exhibit slight under-methylation of endogenous viral DNA and substantial demethylation of minor satellite DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Dnmt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Dnmt3b APN 2 153672502 missense possibly damaging 0.88
IGL00931:Dnmt3b APN 2 153686250 splice site probably benign
IGL01073:Dnmt3b APN 2 153670842 splice site probably benign
IGL01138:Dnmt3b APN 2 153661441 missense probably benign 0.01
IGL01960:Dnmt3b APN 2 153676711 missense possibly damaging 0.83
IGL02884:Dnmt3b APN 2 153674377 missense probably damaging 1.00
IGL03382:Dnmt3b APN 2 153686359 missense probably damaging 1.00
PIT4151001:Dnmt3b UTSW 2 153684479 critical splice donor site probably null
R0062:Dnmt3b UTSW 2 153672272 missense probably benign 0.01
R0122:Dnmt3b UTSW 2 153676698 missense probably damaging 1.00
R0147:Dnmt3b UTSW 2 153661457 missense possibly damaging 0.68
R0178:Dnmt3b UTSW 2 153675018 missense probably benign 0.41
R0751:Dnmt3b UTSW 2 153674842 splice site probably null
R1696:Dnmt3b UTSW 2 153676710 nonsense probably null
R1795:Dnmt3b UTSW 2 153683639 missense possibly damaging 0.92
R2898:Dnmt3b UTSW 2 153667630 missense possibly damaging 0.85
R4201:Dnmt3b UTSW 2 153670417 nonsense probably null
R4630:Dnmt3b UTSW 2 153670315 nonsense probably null
R4870:Dnmt3b UTSW 2 153670364 missense probably benign 0.01
R5648:Dnmt3b UTSW 2 153677198 missense probably damaging 1.00
R5814:Dnmt3b UTSW 2 153672497 missense probably benign 0.00
R6311:Dnmt3b UTSW 2 153674005 missense probably damaging 1.00
R6625:Dnmt3b UTSW 2 153665313 missense probably benign
R6818:Dnmt3b UTSW 2 153686284 missense probably damaging 1.00
R7258:Dnmt3b UTSW 2 153683599 splice site probably null
R7473:Dnmt3b UTSW 2 153684450 missense probably damaging 1.00
R7570:Dnmt3b UTSW 2 153676699 missense probably damaging 1.00
R7627:Dnmt3b UTSW 2 153677580 missense probably benign 0.03
R7709:Dnmt3b UTSW 2 153672220 missense probably benign 0.10
R8483:Dnmt3b UTSW 2 153674386 missense probably damaging 1.00
R8771:Dnmt3b UTSW 2 153662814 missense possibly damaging 0.94
R8775:Dnmt3b UTSW 2 153669791 missense possibly damaging 0.83
R8775-TAIL:Dnmt3b UTSW 2 153669791 missense possibly damaging 0.83
R8821:Dnmt3b UTSW 2 153676814 missense probably benign 0.15
R8850:Dnmt3b UTSW 2 153674013 missense probably benign 0.16
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-30