Incidental Mutation 'R0119:Elmo3'
ID20980
Institutional Source Beutler Lab
Gene Symbol Elmo3
Ensembl Gene ENSMUSG00000014791
Gene Nameengulfment and cell motility 3
SynonymsCED-12
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location105305601-105310760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105309768 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 668 (L668S)
Ref Sequence ENSEMBL: ENSMUSP00000148820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000070508] [ENSMUST00000109375] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199] [ENSMUST00000212033] [ENSMUST00000212046]
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably damaging
Transcript: ENSMUST00000109375
AA Change: L685S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791
AA Change: L685S

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Predicted Effect probably damaging
Transcript: ENSMUST00000212033
AA Change: L668S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Elmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Elmo3 APN 8 105308323 missense probably benign 0.22
IGL02580:Elmo3 APN 8 105308494 missense probably damaging 1.00
IGL03126:Elmo3 APN 8 105306381 missense probably damaging 1.00
IGL03349:Elmo3 APN 8 105306388 missense possibly damaging 0.95
R0244:Elmo3 UTSW 8 105309171 missense probably benign 0.03
R1572:Elmo3 UTSW 8 105308301 missense probably benign 0.03
R1861:Elmo3 UTSW 8 105308581 missense probably damaging 1.00
R2143:Elmo3 UTSW 8 105308673 missense probably damaging 1.00
R2344:Elmo3 UTSW 8 105309161 missense probably damaging 1.00
R2920:Elmo3 UTSW 8 105308059 missense possibly damaging 0.61
R3687:Elmo3 UTSW 8 105308836 critical splice donor site probably null
R3944:Elmo3 UTSW 8 105309220 critical splice donor site probably null
R4992:Elmo3 UTSW 8 105309501 nonsense probably null
R5255:Elmo3 UTSW 8 105307353 missense probably benign 0.08
R5976:Elmo3 UTSW 8 105307647 missense probably damaging 1.00
R6340:Elmo3 UTSW 8 105306747 missense probably damaging 1.00
R6826:Elmo3 UTSW 8 105306746 missense probably damaging 1.00
R7541:Elmo3 UTSW 8 105306714 missense probably damaging 1.00
V8831:Elmo3 UTSW 8 105307061 missense probably benign 0.24
X0060:Elmo3 UTSW 8 105306013 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCTTTCTCCATCAGCTATGACCAC -3'
(R):5'- AACAGGTTTAGCCCACAGGTTCAG -3'

Sequencing Primer
(F):5'- CTCCAAACGGGATGTAAGTGTC -3'
(R):5'- CCACAGGTTCAGAGCTGATTTAAC -3'
Posted On2013-04-11