Incidental Mutation 'R1889:Steap4'
ID 209809
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tiarp, Tnfaip9
MMRRC Submission 039910-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R1889 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 7960457-7982213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 7975892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 151 (R151L)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect probably damaging
Transcript: ENSMUST00000115421
AA Change: R151L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: R151L

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Meta Mutation Damage Score 0.2590 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
R8861:Steap4 UTSW 5 7975672 missense probably benign 0.00
R9287:Steap4 UTSW 5 7976683 missense probably benign 0.05
R9423:Steap4 UTSW 5 7976720 missense probably damaging 0.99
R9504:Steap4 UTSW 5 7980538 missense probably benign 0.00
R9531:Steap4 UTSW 5 7978424 missense probably benign 0.20
R9566:Steap4 UTSW 5 7975646 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GAGAGCACTATGATTCCCTCACG -3'
(R):5'- TGATTCGGTCCCATCAAACTAC -3'

Sequencing Primer
(F):5'- CCCTCACGGAACTAGTTGATTATC -3'
(R):5'- TTCGGTCCCATCAAACTACTAATAC -3'
Posted On 2014-06-30