Mutagenetix > Incidental Mutation

Incidental Mutation 'R1889:Herc6'

209817

Institutional Source

Beutler Lab

Gene Symbol

Herc6

Ensembl Gene

ENSMUSG00000029798

Gene Name

hect domain and RLD 6

Synonyms

Herc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik

MMRRC Submission

039910-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57581000-57664632 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 57662075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 840 (Y840*)

Ref Sequence

ENSEMBL: ENSMUSP00000031817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031817]

AlphaFold

F2Z461

Predicted Effect

probably null
Transcript: ENSMUST00000031817
AA Change: Y840*

SMART Domains

Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: Y840*

Domain	Start	End	E-Value	Type
Pfam:RCC1	40	89	1.9e-12	PFAM
Pfam:RCC1	92	142	4.8e-17	PFAM
Pfam:RCC1_2	129	158	3.4e-14	PFAM
Pfam:RCC1	145	195	1.6e-18	PFAM
Pfam:RCC1_2	183	211	1e-8	PFAM
Pfam:RCC1	198	250	2e-10	PFAM
Pfam:RCC1_2	237	266	4e-10	PFAM
Pfam:RCC1	253	301	4.8e-9	PFAM
low complexity region	359	373	N/A	INTRINSIC
low complexity region	611	626	N/A	INTRINSIC
HECTc	677	1003	1.03e-57	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.6%
20x: 88.0%

Validation Efficiency

97% (103/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,152,762		noncoding transcript	Het
9130008F23Rik	T	C	17: 40,880,302	R79G	probably damaging	Het
Aco1	A	T	4: 40,164,607		probably null	Het
Acp6	C	T	3: 97,165,885	R81W	probably damaging	Het
Agbl1	A	C	7: 76,589,381	Y543S	probably damaging	Het
Anapc7	T	C	5: 122,433,476	W205R	probably damaging	Het
Ap1g2	T	A	14: 55,101,429	M532L	probably damaging	Het
Appl1	A	G	14: 26,925,513		probably benign	Het
Arhgef19	T	C	4: 141,249,313	F462S	probably damaging	Het
Astn1	A	G	1: 158,505,316		probably null	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cadm2	T	C	16: 66,882,795	D50G	probably damaging	Het
Ccdc81	G	A	7: 89,882,294	Q324*	probably null	Het
Cd300lf	A	G	11: 115,120,380	V178A	probably benign	Het
Cdt1	T	C	8: 122,572,052	V476A	possibly damaging	Het
Cenpj	A	G	14: 56,558,725	V225A	probably benign	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Cfap54	A	G	10: 93,034,710	S684P	possibly damaging	Het
Clip1	C	A	5: 123,653,496	V204F	probably damaging	Het
Cnpy4	A	G	5: 138,192,840	E226G	probably benign	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Cpsf1	T	C	15: 76,602,156	M335V	probably benign	Het
Dnmt3b	C	A	2: 153,676,759	A614E	probably benign	Het
Dpm1	C	T	2: 168,217,735	R147Q	possibly damaging	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Engase	T	C	11: 118,478,933	F57S	probably damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gkn2	T	A	6: 87,378,155	Y115*	probably null	Het
Gtdc1	A	G	2: 44,591,914	S246P	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Herc2	C	T	7: 56,189,813	S3357L	possibly damaging	Het
Hoxa10	GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	6: 52,234,492		probably benign	Het
Ift122	T	C	6: 115,894,421		probably null	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Itgb2	A	T	10: 77,548,623	N193Y	possibly damaging	Het
Itgb5	T	G	16: 33,910,469	I65S	probably damaging	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Kcnt2	A	T	1: 140,584,293	H995L	probably damaging	Het
Kif20b	T	C	19: 34,941,208		probably benign	Het
Kif7	T	C	7: 79,710,463	Y342C	probably damaging	Het
Klhl21	T	C	4: 152,015,420	V529A	possibly damaging	Het
Klhl26	T	C	8: 70,451,733	D475G	probably damaging	Het
Lcor	T	C	19: 41,559,128	Y384H	probably damaging	Het
Lrp1b	A	T	2: 40,919,167	C2463*	probably null	Het
March6	T	C	15: 31,459,193	E909G	possibly damaging	Het
Mrc1	A	T	2: 14,308,677		probably null	Het
Nipal4	T	A	11: 46,150,733	I212F	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Nwd2	A	G	5: 63,807,666	E1531G	possibly damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr204	T	G	16: 59,314,963	Y148S	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Opa1	T	C	16: 29,625,585	V863A	possibly damaging	Het
Pabpc4l	A	T	3: 46,446,363	M282K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcnx3	T	C	19: 5,672,656	D1336G	probably damaging	Het
Phlpp1	T	C	1: 106,318,850	V590A	possibly damaging	Het
Rbck1	T	A	2: 152,318,356	T468S	probably damaging	Het
Ripor2	T	A	13: 24,693,887	I290N	probably damaging	Het
Rnf139	T	C	15: 58,899,497	L457P	probably damaging	Het
Rtn1	C	A	12: 72,304,410	A342S	possibly damaging	Het
Sema3d	A	G	5: 12,485,021		probably null	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Sez6l2	T	C	7: 126,953,496	V148A	probably damaging	Het
Shank2	C	A	7: 144,186,858	S568*	probably null	Het
Skiv2l2	T	C	13: 112,887,490	N707S	probably benign	Het
Slc10a4	T	C	5: 73,012,147	S372P	possibly damaging	Het
Slc10a5	T	C	3: 10,335,490	T37A	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Slc6a20b	G	T	9: 123,632,204	D52E	probably benign	Het
Slc6a5	T	C	7: 49,951,434	M661T	probably benign	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Steap4	G	T	5: 7,975,892	R151L	probably damaging	Het
Sun5	T	A	2: 153,865,995	I107L	probably benign	Het
Tacc1	C	T	8: 25,175,253	V488M	probably damaging	Het
Tgs1	A	G	4: 3,614,928	T829A	probably benign	Het
Tnxb	A	G	17: 34,695,825	E1929G	probably damaging	Het
Tssc4	A	C	7: 143,070,555	Q200P	probably damaging	Het
Ttn	A	G	2: 76,758,532	W21398R	probably damaging	Het
Usp50	C	T	2: 126,777,898		probably null	Het
Usp9y	A	T	Y: 1,448,829		probably null	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Zfat	T	C	15: 68,101,539	T1118A	probably benign	Het

Other mutations in Herc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Herc6	APN	6	57607145	missense	probably benign	0.03
IGL00836:Herc6	APN	6	57619549	missense	probably damaging	0.98
IGL01289:Herc6	APN	6	57598623	missense	probably damaging	1.00
IGL01631:Herc6	APN	6	57604107	missense	probably benign	0.03
IGL02656:Herc6	APN	6	57611836	critical splice donor site	probably null
IGL02966:Herc6	APN	6	57583333	critical splice donor site	probably null
IGL03297:Herc6	APN	6	57662389	missense	probably benign	0.03
IGL02835:Herc6	UTSW	6	57646161	missense	possibly damaging	0.94
R0218:Herc6	UTSW	6	57619601	missense	probably benign	0.00
R0470:Herc6	UTSW	6	57619452	missense	probably damaging	1.00
R0699:Herc6	UTSW	6	57581107	missense	probably damaging	1.00
R0702:Herc6	UTSW	6	57581107	missense	probably damaging	1.00
R0707:Herc6	UTSW	6	57662362	missense	possibly damaging	0.81
R0850:Herc6	UTSW	6	57583242	missense	possibly damaging	0.84
R1067:Herc6	UTSW	6	57662219	missense	probably damaging	1.00
R1740:Herc6	UTSW	6	57652065	missense	probably benign
R1840:Herc6	UTSW	6	57658106	nonsense	probably null
R1938:Herc6	UTSW	6	57625941	missense	probably damaging	1.00
R2024:Herc6	UTSW	6	57583332	missense	probably benign	0.04
R2051:Herc6	UTSW	6	57625976	missense	probably benign	0.00
R2238:Herc6	UTSW	6	57654401	missense	probably benign	0.05
R2244:Herc6	UTSW	6	57598617	nonsense	probably null
R4085:Herc6	UTSW	6	57647069	missense	probably benign	0.09
R4410:Herc6	UTSW	6	57659679	missense	possibly damaging	0.82
R4490:Herc6	UTSW	6	57654495	missense	probably damaging	1.00
R4599:Herc6	UTSW	6	57659713	missense	probably benign	0.34
R4716:Herc6	UTSW	6	57598438	missense	probably damaging	1.00
R4757:Herc6	UTSW	6	57600060	critical splice donor site	probably null
R4761:Herc6	UTSW	6	57662900	missense	probably benign	0.01
R4798:Herc6	UTSW	6	57604166	missense	probably damaging	1.00
R4826:Herc6	UTSW	6	57647087	missense	probably benign	0.00
R5520:Herc6	UTSW	6	57647120	missense	possibly damaging	0.51
R5545:Herc6	UTSW	6	57658007	critical splice acceptor site	probably null
R5664:Herc6	UTSW	6	57618684	missense	probably benign
R5763:Herc6	UTSW	6	57662887	missense	probably damaging	1.00
R5916:Herc6	UTSW	6	57646203	missense	probably benign
R6115:Herc6	UTSW	6	57583206	missense	probably benign	0.01
R6225:Herc6	UTSW	6	57662154	missense	possibly damaging	0.50
R7287:Herc6	UTSW	6	57651980	splice site	probably null
R7319:Herc6	UTSW	6	57604089	missense	probably damaging	1.00
R7375:Herc6	UTSW	6	57651806	splice site	probably null
R7480:Herc6	UTSW	6	57581221	missense	possibly damaging	0.66
R7485:Herc6	UTSW	6	57581104	missense	probably benign	0.00
R7670:Herc6	UTSW	6	57660122	missense	probably damaging	1.00
R7740:Herc6	UTSW	6	57659817	splice site	probably null
R7914:Herc6	UTSW	6	57607121	missense	probably benign	0.03
R8356:Herc6	UTSW	6	57598563	missense	probably benign	0.02
R8403:Herc6	UTSW	6	57583206	missense	probably benign	0.01
R8456:Herc6	UTSW	6	57598563	missense	probably benign	0.02
R8473:Herc6	UTSW	6	57647114	missense	probably damaging	0.99
R8696:Herc6	UTSW	6	57647149	missense	probably benign	0.00
R8751:Herc6	UTSW	6	57662374	missense	probably damaging	1.00
R9023:Herc6	UTSW	6	57618627	missense	probably benign	0.01
R9112:Herc6	UTSW	6	57619619	missense	probably damaging	1.00
R9176:Herc6	UTSW	6	57659678	missense	probably benign	0.01
R9210:Herc6	UTSW	6	57662365	missense	probably damaging	1.00
R9390:Herc6	UTSW	6	57625970	nonsense	probably null
R9427:Herc6	UTSW	6	57659737	missense	probably damaging	1.00
R9530:Herc6	UTSW	6	57625914	nonsense	probably null
R9581:Herc6	UTSW	6	57658116	missense	probably damaging	1.00
R9612:Herc6	UTSW	6	57652032	missense	probably benign
Z1176:Herc6	UTSW	6	57600031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACTGTAGAGTCTGAGTCCTTCTC -3'
(R):5'- AAGTTCTAGGAAGGATATGTGTCAG -3'

Sequencing Primer
(F):5'- AGAGTCTGAGTCCTTCTCTTATATTC -3'
(R):5'- AGGATATGTGTCAGTTATTTGGAAAC -3'

Posted On

2014-06-30