Incidental Mutation 'R0119:Sik3'
ID20983
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
Synonyms
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46208740 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 659 (M659T)
Ref Sequence ENSEMBL: ENSMUSP00000112749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: M613T
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: M613T

DomainStartEndE-ValueType
S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120463
AA Change: M659T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: M659T

DomainStartEndE-ValueType
low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126865
AA Change: M709T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: M709T

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0344:Sik3 UTSW 9 46208811 missense probably damaging 0.97
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1017:Sik3 UTSW 9 46195809 missense probably benign 0.00
R1310:Sik3 UTSW 9 46219426 missense possibly damaging 0.81
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1884:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6540:Sik3 UTSW 9 46212053 missense probably benign
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
R7830:Sik3 UTSW 9 46212057 small deletion probably benign
R7875:Sik3 UTSW 9 46123230 missense probably damaging 1.00
R7958:Sik3 UTSW 9 46123230 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATTCCACACTGGGCATTCCAC -3'
(R):5'- CAATGTGCCTGCCAGCAAACTC -3'

Sequencing Primer
(F):5'- GGCATTCCACAGTGTGTCC -3'
(R):5'- TCAAAAACGCATTCTGAGAGAGC -3'
Posted On2013-04-11