Mutagenetix > Incidental Mutation

Incidental Mutation 'R1889:Cep295'

209834

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039910-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R1889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15332103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1686 (T1686A)

Ref Sequence

ENSEMBL: ENSMUSP00000123788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066038

Predicted Effect

probably benign
Transcript: ENSMUST00000098979
AA Change: T1686A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: T1686A

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000160946
AA Change: T430A

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: T430A

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: T1686A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: T1686A

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161795
AA Change: T1638A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: T1638A

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Meta Mutation Damage Score

0.0773

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.6%
20x: 88.0%

Validation Efficiency

97% (103/106)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,152,762		noncoding transcript	Het
9130008F23Rik	T	C	17: 40,880,302	R79G	probably damaging	Het
Aco1	A	T	4: 40,164,607		probably null	Het
Acp6	C	T	3: 97,165,885	R81W	probably damaging	Het
Agbl1	A	C	7: 76,589,381	Y543S	probably damaging	Het
Anapc7	T	C	5: 122,433,476	W205R	probably damaging	Het
Ap1g2	T	A	14: 55,101,429	M532L	probably damaging	Het
Appl1	A	G	14: 26,925,513		probably benign	Het
Arhgef19	T	C	4: 141,249,313	F462S	probably damaging	Het
Astn1	A	G	1: 158,505,316		probably null	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cadm2	T	C	16: 66,882,795	D50G	probably damaging	Het
Ccdc81	G	A	7: 89,882,294	Q324*	probably null	Het
Cd300lf	A	G	11: 115,120,380	V178A	probably benign	Het
Cdt1	T	C	8: 122,572,052	V476A	possibly damaging	Het
Cenpj	A	G	14: 56,558,725	V225A	probably benign	Het
Cfap54	A	G	10: 93,034,710	S684P	possibly damaging	Het
Clip1	C	A	5: 123,653,496	V204F	probably damaging	Het
Cnpy4	A	G	5: 138,192,840	E226G	probably benign	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Cpsf1	T	C	15: 76,602,156	M335V	probably benign	Het
Dnmt3b	C	A	2: 153,676,759	A614E	probably benign	Het
Dpm1	C	T	2: 168,217,735	R147Q	possibly damaging	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Engase	T	C	11: 118,478,933	F57S	probably damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gkn2	T	A	6: 87,378,155	Y115*	probably null	Het
Gtdc1	A	G	2: 44,591,914	S246P	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Herc2	C	T	7: 56,189,813	S3357L	possibly damaging	Het
Herc6	T	A	6: 57,662,075	Y840*	probably null	Het
Hoxa10	GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	6: 52,234,492		probably benign	Het
Ift122	T	C	6: 115,894,421		probably null	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Itgb2	A	T	10: 77,548,623	N193Y	possibly damaging	Het
Itgb5	T	G	16: 33,910,469	I65S	probably damaging	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Kcnt2	A	T	1: 140,584,293	H995L	probably damaging	Het
Kif20b	T	C	19: 34,941,208		probably benign	Het
Kif7	T	C	7: 79,710,463	Y342C	probably damaging	Het
Klhl21	T	C	4: 152,015,420	V529A	possibly damaging	Het
Klhl26	T	C	8: 70,451,733	D475G	probably damaging	Het
Lcor	T	C	19: 41,559,128	Y384H	probably damaging	Het
Lrp1b	A	T	2: 40,919,167	C2463*	probably null	Het
March6	T	C	15: 31,459,193	E909G	possibly damaging	Het
Mrc1	A	T	2: 14,308,677		probably null	Het
Nipal4	T	A	11: 46,150,733	I212F	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Nwd2	A	G	5: 63,807,666	E1531G	possibly damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr204	T	G	16: 59,314,963	Y148S	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Opa1	T	C	16: 29,625,585	V863A	possibly damaging	Het
Pabpc4l	A	T	3: 46,446,363	M282K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcnx3	T	C	19: 5,672,656	D1336G	probably damaging	Het
Phlpp1	T	C	1: 106,318,850	V590A	possibly damaging	Het
Rbck1	T	A	2: 152,318,356	T468S	probably damaging	Het
Ripor2	T	A	13: 24,693,887	I290N	probably damaging	Het
Rnf139	T	C	15: 58,899,497	L457P	probably damaging	Het
Rtn1	C	A	12: 72,304,410	A342S	possibly damaging	Het
Sema3d	A	G	5: 12,485,021		probably null	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Sez6l2	T	C	7: 126,953,496	V148A	probably damaging	Het
Shank2	C	A	7: 144,186,858	S568*	probably null	Het
Skiv2l2	T	C	13: 112,887,490	N707S	probably benign	Het
Slc10a4	T	C	5: 73,012,147	S372P	possibly damaging	Het
Slc10a5	T	C	3: 10,335,490	T37A	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Slc6a20b	G	T	9: 123,632,204	D52E	probably benign	Het
Slc6a5	T	C	7: 49,951,434	M661T	probably benign	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Steap4	G	T	5: 7,975,892	R151L	probably damaging	Het
Sun5	T	A	2: 153,865,995	I107L	probably benign	Het
Tacc1	C	T	8: 25,175,253	V488M	probably damaging	Het
Tgs1	A	G	4: 3,614,928	T829A	probably benign	Het
Tnxb	A	G	17: 34,695,825	E1929G	probably damaging	Het
Tssc4	A	C	7: 143,070,555	Q200P	probably damaging	Het
Ttn	A	G	2: 76,758,532	W21398R	probably damaging	Het
Usp50	C	T	2: 126,777,898		probably null	Het
Usp9y	A	T	Y: 1,448,829		probably null	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Zfat	T	C	15: 68,101,539	T1118A	probably benign	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
R8919:Cep295	UTSW	9	15326711	missense	probably damaging	1.00
R9015:Cep295	UTSW	9	15332968	missense	probably benign	0.00
R9054:Cep295	UTSW	9	15324255	missense	possibly damaging	0.92
R9088:Cep295	UTSW	9	15322519	missense	probably benign	0.09
R9159:Cep295	UTSW	9	15341608	missense	probably benign	0.05
R9243:Cep295	UTSW	9	15332309	missense	probably benign	0.36
R9408:Cep295	UTSW	9	15333323	missense	probably benign	0.00
R9424:Cep295	UTSW	9	15333203	missense	probably damaging	0.98
R9455:Cep295	UTSW	9	15333750	missense	possibly damaging	0.90
R9607:Cep295	UTSW	9	15322713	missense	probably damaging	0.98
R9648:Cep295	UTSW	9	15323607	missense	probably benign	0.00
R9659:Cep295	UTSW	9	15322550	missense	probably benign	0.19
R9731:Cep295	UTSW	9	15333966	missense	possibly damaging	0.94
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- TTATCTGAGAACCCACTGCAAC -3'
(R):5'- TGTTTCTGTCCAAGGAAATAGAGC -3'

Sequencing Primer
(F):5'- TTAAATTCAGAACATACCTGACTGAC -3'
(R):5'- TGTCCAAGGAAATAGAGCATCCATTC -3'

Posted On

2014-06-30