Incidental Mutation 'R1889:Ilf3'
ID209835
Institutional Source Beutler Lab
Gene Symbol Ilf3
Ensembl Gene ENSMUSG00000032178
Gene Nameinterleukin enhancer binding factor 3
SynonymsNF90
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1889 (G1)
Quality Score174
Status Validated
Chromosome9
Chromosomal Location21367871-21405361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 21404767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]
Predicted Effect unknown
Transcript: ENSMUST00000067646
AA Change: Y878N
SMART Domains Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: Y878N

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
low complexity region 691 725 N/A INTRINSIC
low complexity region 745 769 N/A INTRINSIC
low complexity region 777 807 N/A INTRINSIC
low complexity region 810 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115414
SMART Domains Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181812
Predicted Effect unknown
Transcript: ENSMUST00000213518
AA Change: Y888N
Predicted Effect unknown
Transcript: ENSMUST00000213603
AA Change: Y891N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214217
Predicted Effect unknown
Transcript: ENSMUST00000214758
AA Change: Y891N
Predicted Effect probably benign
Transcript: ENSMUST00000215169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215438
Predicted Effect probably benign
Transcript: ENSMUST00000216892
Predicted Effect probably benign
Transcript: ENSMUST00000217348
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Ilf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ilf3 APN 9 21396051 missense probably damaging 1.00
IGL01013:Ilf3 APN 9 21399691 missense possibly damaging 0.91
IGL01352:Ilf3 APN 9 21392322 missense possibly damaging 0.89
IGL01975:Ilf3 APN 9 21392379 missense probably benign 0.03
IGL02826:Ilf3 APN 9 21398044 missense probably benign 0.20
IGL03238:Ilf3 APN 9 21392350 missense probably damaging 1.00
PIT4466001:Ilf3 UTSW 9 21403366 missense unknown
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0090:Ilf3 UTSW 9 21395414 missense probably damaging 1.00
R0355:Ilf3 UTSW 9 21397970 missense probably damaging 1.00
R1768:Ilf3 UTSW 9 21403142 unclassified probably benign
R1895:Ilf3 UTSW 9 21404767 unclassified probably benign
R1918:Ilf3 UTSW 9 21393714 missense probably damaging 1.00
R2930:Ilf3 UTSW 9 21399590 missense possibly damaging 0.91
R3912:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R3913:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R4080:Ilf3 UTSW 9 21403134 critical splice acceptor site probably null
R4412:Ilf3 UTSW 9 21399560 missense possibly damaging 0.77
R4510:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R4511:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R5201:Ilf3 UTSW 9 21389383 missense probably damaging 1.00
R5785:Ilf3 UTSW 9 21394872 missense probably damaging 1.00
R6303:Ilf3 UTSW 9 21403136 unclassified probably benign
R6406:Ilf3 UTSW 9 21396244 missense probably damaging 0.99
R6434:Ilf3 UTSW 9 21403151 unclassified probably benign
R7169:Ilf3 UTSW 9 21395426 missense probably damaging 0.96
R7410:Ilf3 UTSW 9 21399804 missense unknown
R7468:Ilf3 UTSW 9 21403411 missense unknown
R7624:Ilf3 UTSW 9 21398044 missense probably benign 0.20
R7720:Ilf3 UTSW 9 21399537 missense possibly damaging 0.51
R8513:Ilf3 UTSW 9 21388636 missense possibly damaging 0.92
X0066:Ilf3 UTSW 9 21392406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGACATCAGCCCCTAGAG -3'
(R):5'- GTGGCAATGTCAGCAACGTG -3'

Sequencing Primer
(F):5'- ATCAGCCCCTAGAGGCTTGTC -3'
(R):5'- TGTCAGCAACGTGGACGG -3'
Posted On2014-06-30