Mutagenetix > Incidental Mutation

Incidental Mutation 'R1889:Itgb2'

209839

Institutional Source

Beutler Lab

Gene Symbol

Itgb2

Ensembl Gene

ENSMUSG00000000290

Gene Name

integrin beta 2

Synonyms

Mac-1 beta, Cd18, 2E6

MMRRC Submission

039910-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R1889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77530252-77565708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77548623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 193 (N193Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000130059] [ENSMUST00000131023] [ENSMUST00000153541] [ENSMUST00000156644]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000299
AA Change: N193Y

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: N193Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART
internal_repeat_1	459	509	7.99e-5	PROSPERO
EGF_like	535	574	6.81e1	SMART
Integrin_B_tail	622	701	5.53e-22	SMART
transmembrane domain	702	724	N/A	INTRINSIC
Integrin_b_cyt	725	770	1.58e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130059
AA Change: N115Y

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290
AA Change: N115Y

Domain	Start	End	E-Value	Type
INB	1	130	2.21e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131023

SMART Domains

Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
Pfam:Integrin_beta	2	54	7.1e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153541
AA Change: N193Y

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290
AA Change: N193Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156644

SMART Domains

Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PDB:2P28\|A	23	49	9e-12	PDB
Blast:PSI	24	49	2e-11	BLAST

Meta Mutation Damage Score

0.1423

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.6%
20x: 88.0%

Validation Efficiency

97% (103/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,152,762		noncoding transcript	Het
9130008F23Rik	T	C	17: 40,880,302	R79G	probably damaging	Het
Aco1	A	T	4: 40,164,607		probably null	Het
Acp6	C	T	3: 97,165,885	R81W	probably damaging	Het
Agbl1	A	C	7: 76,589,381	Y543S	probably damaging	Het
Anapc7	T	C	5: 122,433,476	W205R	probably damaging	Het
Ap1g2	T	A	14: 55,101,429	M532L	probably damaging	Het
Appl1	A	G	14: 26,925,513		probably benign	Het
Arhgef19	T	C	4: 141,249,313	F462S	probably damaging	Het
Astn1	A	G	1: 158,505,316		probably null	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cadm2	T	C	16: 66,882,795	D50G	probably damaging	Het
Ccdc81	G	A	7: 89,882,294	Q324*	probably null	Het
Cd300lf	A	G	11: 115,120,380	V178A	probably benign	Het
Cdt1	T	C	8: 122,572,052	V476A	possibly damaging	Het
Cenpj	A	G	14: 56,558,725	V225A	probably benign	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Cfap54	A	G	10: 93,034,710	S684P	possibly damaging	Het
Clip1	C	A	5: 123,653,496	V204F	probably damaging	Het
Cnpy4	A	G	5: 138,192,840	E226G	probably benign	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Cpsf1	T	C	15: 76,602,156	M335V	probably benign	Het
Dnmt3b	C	A	2: 153,676,759	A614E	probably benign	Het
Dpm1	C	T	2: 168,217,735	R147Q	possibly damaging	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Engase	T	C	11: 118,478,933	F57S	probably damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gkn2	T	A	6: 87,378,155	Y115*	probably null	Het
Gtdc1	A	G	2: 44,591,914	S246P	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Herc2	C	T	7: 56,189,813	S3357L	possibly damaging	Het
Herc6	T	A	6: 57,662,075	Y840*	probably null	Het
Hoxa10	GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	6: 52,234,492		probably benign	Het
Ift122	T	C	6: 115,894,421		probably null	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Itgb5	T	G	16: 33,910,469	I65S	probably damaging	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Kcnt2	A	T	1: 140,584,293	H995L	probably damaging	Het
Kif20b	T	C	19: 34,941,208		probably benign	Het
Kif7	T	C	7: 79,710,463	Y342C	probably damaging	Het
Klhl21	T	C	4: 152,015,420	V529A	possibly damaging	Het
Klhl26	T	C	8: 70,451,733	D475G	probably damaging	Het
Lcor	T	C	19: 41,559,128	Y384H	probably damaging	Het
Lrp1b	A	T	2: 40,919,167	C2463*	probably null	Het
March6	T	C	15: 31,459,193	E909G	possibly damaging	Het
Mrc1	A	T	2: 14,308,677		probably null	Het
Nipal4	T	A	11: 46,150,733	I212F	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Nwd2	A	G	5: 63,807,666	E1531G	possibly damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr204	T	G	16: 59,314,963	Y148S	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Opa1	T	C	16: 29,625,585	V863A	possibly damaging	Het
Pabpc4l	A	T	3: 46,446,363	M282K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcnx3	T	C	19: 5,672,656	D1336G	probably damaging	Het
Phlpp1	T	C	1: 106,318,850	V590A	possibly damaging	Het
Rbck1	T	A	2: 152,318,356	T468S	probably damaging	Het
Ripor2	T	A	13: 24,693,887	I290N	probably damaging	Het
Rnf139	T	C	15: 58,899,497	L457P	probably damaging	Het
Rtn1	C	A	12: 72,304,410	A342S	possibly damaging	Het
Sema3d	A	G	5: 12,485,021		probably null	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Sez6l2	T	C	7: 126,953,496	V148A	probably damaging	Het
Shank2	C	A	7: 144,186,858	S568*	probably null	Het
Skiv2l2	T	C	13: 112,887,490	N707S	probably benign	Het
Slc10a4	T	C	5: 73,012,147	S372P	possibly damaging	Het
Slc10a5	T	C	3: 10,335,490	T37A	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Slc6a20b	G	T	9: 123,632,204	D52E	probably benign	Het
Slc6a5	T	C	7: 49,951,434	M661T	probably benign	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Steap4	G	T	5: 7,975,892	R151L	probably damaging	Het
Sun5	T	A	2: 153,865,995	I107L	probably benign	Het
Tacc1	C	T	8: 25,175,253	V488M	probably damaging	Het
Tgs1	A	G	4: 3,614,928	T829A	probably benign	Het
Tnxb	A	G	17: 34,695,825	E1929G	probably damaging	Het
Tssc4	A	C	7: 143,070,555	Q200P	probably damaging	Het
Ttn	A	G	2: 76,758,532	W21398R	probably damaging	Het
Usp50	C	T	2: 126,777,898		probably null	Het
Usp9y	A	T	Y: 1,448,829		probably null	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Zfat	T	C	15: 68,101,539	T1118A	probably benign	Het

Other mutations in Itgb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Itgb2	APN	10	77557406	missense	probably damaging	1.00
IGL00427:Itgb2	APN	10	77557956	missense	probably benign	0.13
IGL00500:Itgb2	APN	10	77564724	missense	probably damaging	1.00
IGL01019:Itgb2	APN	10	77542403	missense	possibly damaging	0.94
IGL01104:Itgb2	APN	10	77547194	splice site	probably null
IGL01111:Itgb2	APN	10	77542000	missense	probably damaging	0.98
IGL01574:Itgb2	APN	10	77557964	missense	possibly damaging	0.82
IGL02087:Itgb2	APN	10	77559696	missense	possibly damaging	0.94
IGL02132:Itgb2	APN	10	77550061	missense	probably damaging	1.00
IGL02325:Itgb2	APN	10	77547192	missense	probably damaging	1.00
IGL02505:Itgb2	APN	10	77547218	missense	probably damaging	1.00
IGL02590:Itgb2	APN	10	77559513	missense	probably damaging	1.00
IGL02735:Itgb2	APN	10	77549999	missense	possibly damaging	0.81
almondine	UTSW	10	77548669	missense	probably damaging	1.00
barely	UTSW	10	77548536	splice site	probably benign
fresh	UTSW	10	77556161	missense	probably damaging	0.98
joker	UTSW	10	77549849	intron	probably benign
newhome	UTSW	10	77559681	missense	probably benign	0.00
nibbler	UTSW	10	77561216	critical splice donor site	probably null
Only_just	UTSW	10	77549968	missense	possibly damaging	0.80
salmonid	UTSW	10	77561112	missense	probably benign
trout	UTSW	10	77565188	missense	probably damaging	1.00
R0217:Itgb2	UTSW	10	77548536	splice site	probably benign
R0394:Itgb2	UTSW	10	77542475	missense	probably damaging	1.00
R0396:Itgb2	UTSW	10	77561189	missense	probably damaging	0.97
R1425:Itgb2	UTSW	10	77547296	missense	probably null	1.00
R1499:Itgb2	UTSW	10	77546153	missense	possibly damaging	0.62
R1542:Itgb2	UTSW	10	77559486	missense	probably benign
R1803:Itgb2	UTSW	10	77564790	missense	probably benign	0.15
R2035:Itgb2	UTSW	10	77547199	missense	probably damaging	1.00
R2156:Itgb2	UTSW	10	77560248	missense	probably benign	0.01
R2374:Itgb2	UTSW	10	77559681	missense	probably benign	0.00
R3769:Itgb2	UTSW	10	77549968	missense	possibly damaging	0.80
R3942:Itgb2	UTSW	10	77558033	missense	probably benign	0.31
R4352:Itgb2	UTSW	10	77556167	missense	probably benign	0.10
R4537:Itgb2	UTSW	10	77561216	critical splice donor site	probably null
R4600:Itgb2	UTSW	10	77546115	missense	probably benign
R4611:Itgb2	UTSW	10	77550050	missense	probably damaging	1.00
R4685:Itgb2	UTSW	10	77550103	critical splice donor site	probably null
R4717:Itgb2	UTSW	10	77546044	nonsense	probably null
R5068:Itgb2	UTSW	10	77548761	missense	probably damaging	1.00
R5297:Itgb2	UTSW	10	77564667	missense	probably damaging	1.00
R5355:Itgb2	UTSW	10	77558052	missense	probably benign
R5927:Itgb2	UTSW	10	77546034	missense	probably damaging	1.00
R6371:Itgb2	UTSW	10	77548597	missense	probably damaging	1.00
R6505:Itgb2	UTSW	10	77559673	missense	probably damaging	1.00
R7305:Itgb2	UTSW	10	77548564	missense	probably damaging	1.00
R7574:Itgb2	UTSW	10	77560158	missense	probably benign	0.18
R7606:Itgb2	UTSW	10	77556161	missense	probably damaging	0.98
R7772:Itgb2	UTSW	10	77561112	missense	probably benign
R7888:Itgb2	UTSW	10	77564644	missense	probably benign	0.00
R8716:Itgb2	UTSW	10	77557953	missense	probably damaging	0.99
R8933:Itgb2	UTSW	10	77565188	missense	probably damaging	1.00
R9082:Itgb2	UTSW	10	77548669	missense	probably damaging	1.00
R9479:Itgb2	UTSW	10	77561108	missense	probably benign	0.01
Z1176:Itgb2	UTSW	10	77557962	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCACTGTCATGCCTGGAGC -3'
(R):5'- AACAGGGACAATGGCCTCAC -3'

Sequencing Primer
(F):5'- TCATGCCTGGAGCCCTGC -3'
(R):5'- CCGGACATGCAGCAACTTG -3'

Posted On

2014-06-30