Incidental Mutation 'R1889:Cd300lf'
ID 209845
Institutional Source Beutler Lab
Gene Symbol Cd300lf
Ensembl Gene ENSMUSG00000047798
Gene Name CD300 molecule like family member F
Synonyms IgSF13, IREM1, CLM-1, DIgR2, LMIR3, Pigr3, F730004D16Rik
MMRRC Submission 039910-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1889 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115116214-115133992 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115120380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000053983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051264] [ENSMUST00000067754] [ENSMUST00000106561] [ENSMUST00000106562]
AlphaFold Q6SJQ7
PDB Structure CLM-1 Mouse Myeloid Receptor Extracellular Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000051264
AA Change: V178A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053983
Gene: ENSMUSG00000047798
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 131 154 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:SIT 187 293 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067754
SMART Domains Protein: ENSMUSP00000065016
Gene: ENSMUSG00000020732

DomainStartEndE-ValueType
RAB 23 187 1.27e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106561
AA Change: V185A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102171
Gene: ENSMUSG00000047798
AA Change: V185A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 130 155 N/A INTRINSIC
low complexity region 170 191 N/A INTRINSIC
Pfam:SIT 194 299 3.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106562
AA Change: V144A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102172
Gene: ENSMUSG00000047798
AA Change: V144A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 127 150 N/A INTRINSIC
Pfam:SIT 153 259 7.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149335
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD300 protein family. Members of this family are cell surface glycoproteins with a single IgV-like extracellular domain, and are involved in the regulation of immune response. The encoded protein is an inhibitory receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased severity of experimental autoimmune encephalomyelitis with increased demyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Cd300lf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Cd300lf APN 11 115124333 missense probably benign 0.34
IGL01364:Cd300lf APN 11 115126350 missense probably benign 0.16
IGL01419:Cd300lf APN 11 115126354 missense probably benign 0.32
IGL01812:Cd300lf APN 11 115120288 missense probably damaging 0.98
IGL03217:Cd300lf APN 11 115124291 missense possibly damaging 0.80
R3899:Cd300lf UTSW 11 115124351 missense probably damaging 1.00
R4180:Cd300lf UTSW 11 115124263 missense possibly damaging 0.55
R5362:Cd300lf UTSW 11 115117114 missense probably damaging 1.00
R5865:Cd300lf UTSW 11 115126300 missense probably damaging 0.99
R6267:Cd300lf UTSW 11 115124369 missense probably benign 0.05
R6296:Cd300lf UTSW 11 115124369 missense probably benign 0.05
R8920:Cd300lf UTSW 11 115126354 missense probably benign 0.32
R8946:Cd300lf UTSW 11 115133912 start gained probably benign
R9380:Cd300lf UTSW 11 115124327 missense probably benign 0.09
R9548:Cd300lf UTSW 11 115117032 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGGATGGTCCCTCAGAC -3'
(R):5'- CTTTGAAGGTGTTCAGAGCG -3'

Sequencing Primer
(F):5'- TCTCAGAAGGCAGTGCTAGC -3'
(R):5'- TGTTCAGAGCGAGGGTCC -3'
Posted On 2014-06-30