Incidental Mutation 'R1889:Ripor2'
ID 209848
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene Name RHO family interacting cell polarization regulator 2
Synonyms 1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik
MMRRC Submission 039910-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R1889 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 24685513-24917789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24877870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 290 (I290N)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
AlphaFold Q80U16
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: I290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: I290N

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058009
AA Change: I290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: I290N

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: I293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: I293N

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: I265N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: I265N

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: I290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: I290N

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175986
Meta Mutation Damage Score 0.9084 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,034,815 (GRCm39) noncoding transcript Het
9130008F23Rik T C 17: 41,191,193 (GRCm39) R79G probably damaging Het
Aco1 A T 4: 40,164,607 (GRCm39) probably null Het
Acp6 C T 3: 97,073,201 (GRCm39) R81W probably damaging Het
Agbl1 A C 7: 76,239,129 (GRCm39) Y543S probably damaging Het
Anapc7 T C 5: 122,571,539 (GRCm39) W205R probably damaging Het
Ap1g2 T A 14: 55,338,886 (GRCm39) M532L probably damaging Het
Appl1 A G 14: 26,647,470 (GRCm39) probably benign Het
Arhgef19 T C 4: 140,976,624 (GRCm39) F462S probably damaging Het
Astn1 A G 1: 158,332,886 (GRCm39) probably null Het
AU015836 T C X: 93,012,985 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Cadm2 T C 16: 66,679,683 (GRCm39) D50G probably damaging Het
Ccdc81 G A 7: 89,531,502 (GRCm39) Q324* probably null Het
Cd300lf A G 11: 115,011,206 (GRCm39) V178A probably benign Het
Cdt1 T C 8: 123,298,791 (GRCm39) V476A possibly damaging Het
Cenpj A G 14: 56,796,182 (GRCm39) V225A probably benign Het
Cep295 T C 9: 15,243,399 (GRCm39) T1686A possibly damaging Het
Cfap54 A G 10: 92,870,572 (GRCm39) S684P possibly damaging Het
Clip1 C A 5: 123,791,559 (GRCm39) V204F probably damaging Het
Cnpy4 A G 5: 138,191,102 (GRCm39) E226G probably benign Het
Col6a3 T A 1: 90,731,433 (GRCm39) M1000L probably benign Het
Cpsf1 T C 15: 76,486,356 (GRCm39) M335V probably benign Het
Dnmt3b C A 2: 153,518,679 (GRCm39) A614E probably benign Het
Dpm1 C T 2: 168,059,655 (GRCm39) R147Q possibly damaging Het
Dpp7 G T 2: 25,243,691 (GRCm39) probably null Het
Engase T C 11: 118,369,759 (GRCm39) F57S probably damaging Het
Epb41l5 T C 1: 119,476,902 (GRCm39) D718G possibly damaging Het
Fam20a T C 11: 109,564,380 (GRCm39) K458E probably benign Het
Fbxo44 C G 4: 148,240,726 (GRCm39) R220S probably damaging Het
Gkn2 T A 6: 87,355,137 (GRCm39) Y115* probably null Het
Gtdc1 A G 2: 44,481,926 (GRCm39) S246P probably damaging Het
H2-Q2 A G 17: 35,564,152 (GRCm39) D302G probably benign Het
Herc2 C T 7: 55,839,561 (GRCm39) S3357L possibly damaging Het
Herc6 T A 6: 57,639,060 (GRCm39) Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,211,472 (GRCm39) probably benign Het
Ift122 T C 6: 115,871,382 (GRCm39) probably null Het
Ilf3 T A 9: 21,316,063 (GRCm39) probably benign Het
Itgb2 A T 10: 77,384,457 (GRCm39) N193Y possibly damaging Het
Itgb5 T G 16: 33,730,839 (GRCm39) I65S probably damaging Het
Jpt2 T C 17: 25,179,585 (GRCm39) M1V probably null Het
Kcnt2 A T 1: 140,512,031 (GRCm39) H995L probably damaging Het
Kif20b T C 19: 34,918,608 (GRCm39) probably benign Het
Kif7 T C 7: 79,360,211 (GRCm39) Y342C probably damaging Het
Klhl21 T C 4: 152,099,877 (GRCm39) V529A possibly damaging Het
Klhl26 T C 8: 70,904,383 (GRCm39) D475G probably damaging Het
Lcor T C 19: 41,547,567 (GRCm39) Y384H probably damaging Het
Lrp1b A T 2: 40,809,179 (GRCm39) C2463* probably null Het
Marchf6 T C 15: 31,459,339 (GRCm39) E909G possibly damaging Het
Mrc1 A T 2: 14,313,488 (GRCm39) probably null Het
Mtrex T C 13: 113,024,024 (GRCm39) N707S probably benign Het
Nipal4 T A 11: 46,041,560 (GRCm39) I212F probably damaging Het
Nup98 T A 7: 101,809,923 (GRCm39) T536S probably damaging Het
Nwd2 A G 5: 63,965,009 (GRCm39) E1531G possibly damaging Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Oosp1 C T 19: 11,645,158 (GRCm39) V169I possibly damaging Het
Opa1 T C 16: 29,444,403 (GRCm39) V863A possibly damaging Het
Or5ac22 T G 16: 59,135,326 (GRCm39) Y148S probably damaging Het
Pabpc4l A T 3: 46,400,798 (GRCm39) M282K probably benign Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pcnx3 T C 19: 5,722,684 (GRCm39) D1336G probably damaging Het
Phlpp1 T C 1: 106,246,580 (GRCm39) V590A possibly damaging Het
Rbck1 T A 2: 152,160,276 (GRCm39) T468S probably damaging Het
Rnf139 T C 15: 58,771,346 (GRCm39) L457P probably damaging Het
Rtn1 C A 12: 72,351,184 (GRCm39) A342S possibly damaging Het
Sema3d A G 5: 12,534,988 (GRCm39) probably null Het
Serpinb2 T A 1: 107,452,337 (GRCm39) V305D probably damaging Het
Sez6l2 T C 7: 126,552,668 (GRCm39) V148A probably damaging Het
Shank2 C A 7: 143,740,595 (GRCm39) S568* probably null Het
Slc10a4 T C 5: 73,169,490 (GRCm39) S372P possibly damaging Het
Slc10a5 T C 3: 10,400,550 (GRCm39) T37A probably benign Het
Slc14a1 T C 18: 78,152,912 (GRCm39) I276V possibly damaging Het
Slc6a20b G T 9: 123,461,269 (GRCm39) D52E probably benign Het
Slc6a5 T C 7: 49,601,182 (GRCm39) M661T probably benign Het
Ssh2 C G 11: 77,340,571 (GRCm39) D574E probably damaging Het
Steap4 G T 5: 8,025,892 (GRCm39) R151L probably damaging Het
Sun5 T A 2: 153,707,915 (GRCm39) I107L probably benign Het
Tacc1 C T 8: 25,665,269 (GRCm39) V488M probably damaging Het
Tgs1 A G 4: 3,614,928 (GRCm39) T829A probably benign Het
Tnxb A G 17: 34,914,799 (GRCm39) E1929G probably damaging Het
Tssc4 A C 7: 142,624,292 (GRCm39) Q200P probably damaging Het
Ttn A G 2: 76,588,876 (GRCm39) W21398R probably damaging Het
Usp50 C T 2: 126,619,818 (GRCm39) probably null Het
Usp9y A T Y: 1,448,829 (GRCm39) probably null Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Zfat T C 15: 67,973,388 (GRCm39) T1118A probably benign Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24,885,190 (GRCm39) missense probably benign 0.11
IGL02145:Ripor2 APN 13 24,901,554 (GRCm39) missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24,879,549 (GRCm39) splice site probably benign
IGL02533:Ripor2 APN 13 24,885,378 (GRCm39) nonsense probably null
IGL02798:Ripor2 APN 13 24,858,649 (GRCm39) missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24,879,681 (GRCm39) missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24,880,512 (GRCm39) missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24,907,702 (GRCm39) missense probably damaging 1.00
gentleman UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
Jack UTSW 13 24,861,824 (GRCm39) nonsense probably null
whitechapel UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R0045:Ripor2 UTSW 13 24,878,209 (GRCm39) missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24,864,615 (GRCm39) missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24,864,627 (GRCm39) missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24,878,169 (GRCm39) missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24,861,824 (GRCm39) nonsense probably null
R1374:Ripor2 UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R1564:Ripor2 UTSW 13 24,859,768 (GRCm39) missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24,885,237 (GRCm39) missense probably benign 0.10
R2122:Ripor2 UTSW 13 24,897,701 (GRCm39) missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24,905,817 (GRCm39) critical splice donor site probably null
R2209:Ripor2 UTSW 13 24,885,595 (GRCm39) missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24,855,755 (GRCm39) missense probably benign 0.08
R2392:Ripor2 UTSW 13 24,890,206 (GRCm39) missense probably benign 0.00
R2994:Ripor2 UTSW 13 24,885,610 (GRCm39) missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24,880,521 (GRCm39) missense probably benign
R4287:Ripor2 UTSW 13 24,908,992 (GRCm39) missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4365:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4366:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4868:Ripor2 UTSW 13 24,878,124 (GRCm39) missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24,858,649 (GRCm39) missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24,798,627 (GRCm39) start gained probably benign
R6157:Ripor2 UTSW 13 24,885,052 (GRCm39) missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24,894,113 (GRCm39) missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24,861,828 (GRCm39) missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24,859,803 (GRCm39) missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24,890,215 (GRCm39) missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24,855,829 (GRCm39) missense probably benign 0.00
R7041:Ripor2 UTSW 13 24,877,749 (GRCm39) missense probably benign 0.18
R7196:Ripor2 UTSW 13 24,888,808 (GRCm39) missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24,855,886 (GRCm39) missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24,885,427 (GRCm39) nonsense probably null
R7417:Ripor2 UTSW 13 24,880,533 (GRCm39) missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24,878,188 (GRCm39) missense probably benign 0.01
R7448:Ripor2 UTSW 13 24,854,054 (GRCm39) missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24,880,290 (GRCm39) missense unknown
R7499:Ripor2 UTSW 13 24,877,755 (GRCm39) missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24,897,683 (GRCm39) missense probably benign 0.01
R8157:Ripor2 UTSW 13 24,879,600 (GRCm39) missense probably benign 0.05
R8364:Ripor2 UTSW 13 24,894,176 (GRCm39) missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24,907,771 (GRCm39) missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24,849,451 (GRCm39) intron probably benign
R8751:Ripor2 UTSW 13 24,885,050 (GRCm39) missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24,901,651 (GRCm39) missense possibly damaging 0.93
R8867:Ripor2 UTSW 13 24,822,760 (GRCm39) intron probably benign
R9079:Ripor2 UTSW 13 24,915,637 (GRCm39) missense probably benign 0.35
R9187:Ripor2 UTSW 13 24,897,632 (GRCm39) missense probably benign 0.01
R9316:Ripor2 UTSW 13 24,905,719 (GRCm39) missense probably benign 0.09
R9320:Ripor2 UTSW 13 24,915,663 (GRCm39) missense probably damaging 1.00
R9355:Ripor2 UTSW 13 24,885,694 (GRCm39) missense probably benign 0.00
R9655:Ripor2 UTSW 13 24,908,983 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGATTCCTGGCTCTTGGATCTG -3'
(R):5'- TGTGAGTCGCCAGTCCTTTG -3'

Sequencing Primer
(F):5'- GCTCTTGGATCTGGGCAATTG -3'
(R):5'- TTGCACACAGAGAGACCT -3'
Posted On 2014-06-30