Incidental Mutation 'R1889:Zfat'
Institutional Source Beutler Lab
Gene Symbol Zfat
Ensembl Gene ENSMUSG00000022335
Gene Namezinc finger and AT hook domain containing
SynonymsLOC380993, Zfat1, Zfp406
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosomal Location68083764-68258856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68101539 bp
Amino Acid Change Threonine to Alanine at position 1118 (T1118A)
Ref Sequence ENSEMBL: ENSMUSP00000125732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]
PDB Structure
Solution structure of the 5th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Solution structure of the 8th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000160248
AA Change: T1136A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: T1136A

ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1073 1082 N/A INTRINSIC
low complexity region 1139 1149 N/A INTRINSIC
low complexity region 1218 1236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162054
AA Change: T1118A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: T1118A

ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
ZnF_C2H2 319 342 2.36e-2 SMART
ZnF_C2H2 347 370 4.4e-2 SMART
ZnF_C2H2 397 419 1.67e-2 SMART
ZnF_C2H2 425 447 1.33e-1 SMART
ZnF_C2H2 451 474 2.05e-2 SMART
low complexity region 594 610 N/A INTRINSIC
ZnF_C2H2 730 752 1.43e-1 SMART
ZnF_C2H2 758 781 3.52e-1 SMART
ZnF_C2H2 786 810 5.59e-4 SMART
ZnF_C2H2 818 841 3.83e-2 SMART
ZnF_C2H2 868 891 3.95e1 SMART
ZnF_C2H2 897 919 6.88e-4 SMART
ZnF_C2H2 925 947 8.94e-3 SMART
ZnF_C2H2 954 976 2.27e-4 SMART
ZnF_C2H2 982 1005 9.3e-1 SMART
ZnF_C2H2 1029 1052 5.21e-4 SMART
low complexity region 1121 1131 N/A INTRINSIC
low complexity region 1200 1218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162173
SMART Domains Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335

ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1133 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Other mutations in Zfat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Zfat APN 15 68170222 missense possibly damaging 0.92
IGL00862:Zfat APN 15 68258663 splice site probably null
IGL01021:Zfat APN 15 68170166 missense possibly damaging 0.50
IGL01152:Zfat APN 15 68110504 missense probably damaging 1.00
IGL01733:Zfat APN 15 68180730 missense probably damaging 1.00
IGL01873:Zfat APN 15 68224895 missense probably benign 0.00
IGL01990:Zfat APN 15 68224817 missense probably damaging 1.00
IGL02066:Zfat APN 15 68180829 missense probably damaging 1.00
IGL02664:Zfat APN 15 68180721 missense probably damaging 1.00
IGL02955:Zfat APN 15 68181114 missense probably damaging 0.98
IGL03201:Zfat APN 15 68165909 missense probably damaging 1.00
R0145:Zfat UTSW 15 68187099 missense possibly damaging 0.95
R0408:Zfat UTSW 15 68180292 missense probably benign 0.10
R0633:Zfat UTSW 15 68180803 missense probably damaging 1.00
R1147:Zfat UTSW 15 68212583 splice site probably benign
R1508:Zfat UTSW 15 68178751 missense probably damaging 1.00
R1513:Zfat UTSW 15 68212680 missense probably damaging 1.00
R1641:Zfat UTSW 15 68180110 missense probably benign 0.19
R1959:Zfat UTSW 15 68146543 missense probably benign 0.32
R2030:Zfat UTSW 15 68118934 critical splice donor site probably null
R2202:Zfat UTSW 15 68179860 missense probably benign 0.36
R2340:Zfat UTSW 15 68101541 missense probably damaging 0.99
R3440:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68101581 missense probably damaging 0.99
R4406:Zfat UTSW 15 68180191 missense probably benign 0.00
R4649:Zfat UTSW 15 68184476 missense probably damaging 1.00
R4710:Zfat UTSW 15 68180282 missense probably benign
R4712:Zfat UTSW 15 68110475 critical splice donor site probably null
R4745:Zfat UTSW 15 68180374 missense probably benign 0.09
R4862:Zfat UTSW 15 68180110 missense probably benign 0.02
R5015:Zfat UTSW 15 68178913 missense probably damaging 1.00
R5075:Zfat UTSW 15 68180230 missense probably benign
R5208:Zfat UTSW 15 68180721 missense probably damaging 1.00
R5277:Zfat UTSW 15 68165909 missense probably damaging 1.00
R5303:Zfat UTSW 15 68110486 missense probably damaging 1.00
R5328:Zfat UTSW 15 68179828 missense probably damaging 0.99
R5642:Zfat UTSW 15 68180916 missense probably damaging 1.00
R5659:Zfat UTSW 15 68119013 missense probably damaging 1.00
R5947:Zfat UTSW 15 68179957 missense probably benign
R6046:Zfat UTSW 15 68180777 missense probably damaging 0.99
R6315:Zfat UTSW 15 68084462 missense probably damaging 1.00
R6342:Zfat UTSW 15 68180982 missense probably damaging 1.00
R6573:Zfat UTSW 15 68165854 missense probably damaging 1.00
R6789:Zfat UTSW 15 68084386 missense probably damaging 1.00
R7028:Zfat UTSW 15 68180452 missense probably damaging 1.00
R7033:Zfat UTSW 15 68181015 missense probably damaging 1.00
R7039:Zfat UTSW 15 68180362 missense probably benign
R7065:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7144:Zfat UTSW 15 68178782 missense probably benign 0.12
R7208:Zfat UTSW 15 68180007 missense probably benign 0.39
R7330:Zfat UTSW 15 68212751 missense probably benign 0.00
R7345:Zfat UTSW 15 68105043 missense probably damaging 1.00
R7378:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7405:Zfat UTSW 15 68184485 missense probably damaging 1.00
R7481:Zfat UTSW 15 68178866 nonsense probably null
R7672:Zfat UTSW 15 68258686 start codon destroyed probably null 0.39
R7676:Zfat UTSW 15 68224844 missense possibly damaging 0.88
R7701:Zfat UTSW 15 68180908 nonsense probably null
R7825:Zfat UTSW 15 68179920 missense probably benign 0.01
R8152:Zfat UTSW 15 68101506 missense probably benign 0.23
Z1088:Zfat UTSW 15 68187101 missense probably benign 0.00
Z1177:Zfat UTSW 15 68179828 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-30