Mutagenetix > Incidental Mutation

Incidental Mutation 'R1889:Cpsf1'

209857

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

039910-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R1889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76602156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 335 (M335V)

Ref Sequence

ENSEMBL: ENSMUSP00000071794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]

AlphaFold

Q9EPU4

Predicted Effect

probably benign
Transcript: ENSMUST00000071898
AA Change: M335V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: M335V

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229982

Predicted Effect

probably benign
Transcript: ENSMUST00000230157
AA Change: M335V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230149

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231191

Meta Mutation Damage Score

0.0998

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.6%
20x: 88.0%

Validation Efficiency

97% (103/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,152,762		noncoding transcript	Het
9130008F23Rik	T	C	17: 40,880,302	R79G	probably damaging	Het
Aco1	A	T	4: 40,164,607		probably null	Het
Acp6	C	T	3: 97,165,885	R81W	probably damaging	Het
Agbl1	A	C	7: 76,589,381	Y543S	probably damaging	Het
Anapc7	T	C	5: 122,433,476	W205R	probably damaging	Het
Ap1g2	T	A	14: 55,101,429	M532L	probably damaging	Het
Appl1	A	G	14: 26,925,513		probably benign	Het
Arhgef19	T	C	4: 141,249,313	F462S	probably damaging	Het
Astn1	A	G	1: 158,505,316		probably null	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cadm2	T	C	16: 66,882,795	D50G	probably damaging	Het
Ccdc81	G	A	7: 89,882,294	Q324*	probably null	Het
Cd300lf	A	G	11: 115,120,380	V178A	probably benign	Het
Cdt1	T	C	8: 122,572,052	V476A	possibly damaging	Het
Cenpj	A	G	14: 56,558,725	V225A	probably benign	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Cfap54	A	G	10: 93,034,710	S684P	possibly damaging	Het
Clip1	C	A	5: 123,653,496	V204F	probably damaging	Het
Cnpy4	A	G	5: 138,192,840	E226G	probably benign	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Dnmt3b	C	A	2: 153,676,759	A614E	probably benign	Het
Dpm1	C	T	2: 168,217,735	R147Q	possibly damaging	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Engase	T	C	11: 118,478,933	F57S	probably damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gkn2	T	A	6: 87,378,155	Y115*	probably null	Het
Gtdc1	A	G	2: 44,591,914	S246P	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Herc2	C	T	7: 56,189,813	S3357L	possibly damaging	Het
Herc6	T	A	6: 57,662,075	Y840*	probably null	Het
Hoxa10	GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	6: 52,234,492		probably benign	Het
Ift122	T	C	6: 115,894,421		probably null	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Itgb2	A	T	10: 77,548,623	N193Y	possibly damaging	Het
Itgb5	T	G	16: 33,910,469	I65S	probably damaging	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Kcnt2	A	T	1: 140,584,293	H995L	probably damaging	Het
Kif20b	T	C	19: 34,941,208		probably benign	Het
Kif7	T	C	7: 79,710,463	Y342C	probably damaging	Het
Klhl21	T	C	4: 152,015,420	V529A	possibly damaging	Het
Klhl26	T	C	8: 70,451,733	D475G	probably damaging	Het
Lcor	T	C	19: 41,559,128	Y384H	probably damaging	Het
Lrp1b	A	T	2: 40,919,167	C2463*	probably null	Het
March6	T	C	15: 31,459,193	E909G	possibly damaging	Het
Mrc1	A	T	2: 14,308,677		probably null	Het
Nipal4	T	A	11: 46,150,733	I212F	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Nwd2	A	G	5: 63,807,666	E1531G	possibly damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr204	T	G	16: 59,314,963	Y148S	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Opa1	T	C	16: 29,625,585	V863A	possibly damaging	Het
Pabpc4l	A	T	3: 46,446,363	M282K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcnx3	T	C	19: 5,672,656	D1336G	probably damaging	Het
Phlpp1	T	C	1: 106,318,850	V590A	possibly damaging	Het
Rbck1	T	A	2: 152,318,356	T468S	probably damaging	Het
Ripor2	T	A	13: 24,693,887	I290N	probably damaging	Het
Rnf139	T	C	15: 58,899,497	L457P	probably damaging	Het
Rtn1	C	A	12: 72,304,410	A342S	possibly damaging	Het
Sema3d	A	G	5: 12,485,021		probably null	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Sez6l2	T	C	7: 126,953,496	V148A	probably damaging	Het
Shank2	C	A	7: 144,186,858	S568*	probably null	Het
Skiv2l2	T	C	13: 112,887,490	N707S	probably benign	Het
Slc10a4	T	C	5: 73,012,147	S372P	possibly damaging	Het
Slc10a5	T	C	3: 10,335,490	T37A	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Slc6a20b	G	T	9: 123,632,204	D52E	probably benign	Het
Slc6a5	T	C	7: 49,951,434	M661T	probably benign	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Steap4	G	T	5: 7,975,892	R151L	probably damaging	Het
Sun5	T	A	2: 153,865,995	I107L	probably benign	Het
Tacc1	C	T	8: 25,175,253	V488M	probably damaging	Het
Tgs1	A	G	4: 3,614,928	T829A	probably benign	Het
Tnxb	A	G	17: 34,695,825	E1929G	probably damaging	Het
Tssc4	A	C	7: 143,070,555	Q200P	probably damaging	Het
Ttn	A	G	2: 76,758,532	W21398R	probably damaging	Het
Usp50	C	T	2: 126,777,898		probably null	Het
Usp9y	A	T	Y: 1,448,829		probably null	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Zfat	T	C	15: 68,101,539	T1118A	probably benign	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2847:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6595:Cpsf1	UTSW	15	76602510	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R6954:Cpsf1	UTSW	15	76599496	missense	probably damaging	1.00
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7255:Cpsf1	UTSW	15	76597543	missense	probably damaging	1.00
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
R7878:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
R8334:Cpsf1	UTSW	15	76603587	missense	probably benign	0.26
R8345:Cpsf1	UTSW	15	76601490	missense	probably benign
R8382:Cpsf1	UTSW	15	76600951	missense	probably benign
R8403:Cpsf1	UTSW	15	76600283	missense	probably damaging	0.96
R8968:Cpsf1	UTSW	15	76601969	nonsense	probably null
R8972:Cpsf1	UTSW	15	76597328	missense	probably damaging	1.00
R9257:Cpsf1	UTSW	15	76600792	missense	probably benign
R9627:Cpsf1	UTSW	15	76599888	missense	probably damaging	0.97
R9776:Cpsf1	UTSW	15	76602579	missense	probably damaging	1.00
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TAAGGACACTAGCAGCTGCC -3'
(R):5'- CTTTCCCATTGCGTAAGTGGGG -3'

Sequencing Primer
(F):5'- TAGCAGCTGCCTTGTCAAAG -3'
(R):5'- CATTGCGTAAGTGGGGTGCAC -3'

Posted On

2014-06-30