Incidental Mutation 'R0119:Acpp'
ID20986
Institutional Source Beutler Lab
Gene Symbol Acpp
Ensembl Gene ENSMUSG00000032561
Gene Nameacid phosphatase, prostate
SynonymsA030005E02Rik, PAP
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0119 (G1)
Quality Score173
Status Validated (trace)
Chromosome9
Chromosomal Location104288251-104337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104320002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 146 (E146G)
Ref Sequence ENSEMBL: ENSMUSP00000150874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590] [ENSMUST00000215852]
Predicted Effect probably damaging
Transcript: ENSMUST00000062723
AA Change: E175G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561
AA Change: E175G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112590
AA Change: E175G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561
AA Change: E175G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128635
Predicted Effect probably damaging
Transcript: ENSMUST00000215852
AA Change: E146G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4499 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Acpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acpp APN 9 104326948 missense probably damaging 1.00
IGL02994:Acpp APN 9 104309403 splice site probably benign
IGL03069:Acpp APN 9 104320005 missense possibly damaging 0.78
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0084:Acpp UTSW 9 104314365 missense probably benign 0.07
R0098:Acpp UTSW 9 104319945 unclassified probably null
R0299:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0362:Acpp UTSW 9 104314427 missense probably damaging 1.00
R0499:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0514:Acpp UTSW 9 104319978 missense probably damaging 1.00
R0964:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R1506:Acpp UTSW 9 104324174 missense probably damaging 1.00
R1624:Acpp UTSW 9 104320001 missense probably benign 0.39
R2019:Acpp UTSW 9 104324702 missense probably damaging 1.00
R3821:Acpp UTSW 9 104324717 missense probably damaging 0.99
R3822:Acpp UTSW 9 104324717 missense probably damaging 0.99
R4896:Acpp UTSW 9 104306975 missense probably damaging 1.00
R5084:Acpp UTSW 9 104326917 missense probably damaging 1.00
R5257:Acpp UTSW 9 104309475 missense probably benign 0.24
R5258:Acpp UTSW 9 104309475 missense probably benign 0.24
R5519:Acpp UTSW 9 104291488 missense probably damaging 1.00
R5795:Acpp UTSW 9 104309489 missense probably benign 0.04
R6909:Acpp UTSW 9 104300965 missense probably damaging 1.00
R7315:Acpp UTSW 9 104316224 critical splice donor site probably null
R7349:Acpp UTSW 9 104291458 missense probably benign 0.01
R7792:Acpp UTSW 9 104326966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTTATCCTGAAAAGCGAGTCC -3'
(R):5'- AAGGTTGGCACCAAGTCTCTGC -3'

Sequencing Primer
(F):5'- TGAAAAGCGAGTCCTTCCC -3'
(R):5'- CGGGCTCTCGCTTGAATAATC -3'
Posted On2013-04-11