Mutagenetix > Incidental Mutation

Incidental Mutation 'R1889:Kif20b'

209871

Institutional Source

Beutler Lab

Gene Symbol

Kif20b

Ensembl Gene

ENSMUSG00000024795

Gene Name

kinesin family member 20B

Synonyms

Kif20b, Mphosph1, N-6 kinesin

MMRRC Submission

039910-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R1889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34922361-34975745 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 34941208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000225408]

AlphaFold

Q80WE4

Predicted Effect

probably benign
Transcript: ENSMUST00000087341

SMART Domains

Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795

Domain	Start	End	E-Value	Type
Blast:KISc	2	46	5e-15	BLAST
KISc	56	483	1.19e-103	SMART
low complexity region	521	551	N/A	INTRINSIC
coiled coil region	565	602	N/A	INTRINSIC
coiled coil region	705	746	N/A	INTRINSIC
coiled coil region	823	947	N/A	INTRINSIC
coiled coil region	1020	1325	N/A	INTRINSIC
coiled coil region	1348	1510	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223907

Predicted Effect

probably benign
Transcript: ENSMUST00000224728

Predicted Effect

probably benign
Transcript: ENSMUST00000225408

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.6%
20x: 88.0%

Validation Efficiency

97% (103/106)

MGI Phenotype

PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,152,762		noncoding transcript	Het
9130008F23Rik	T	C	17: 40,880,302	R79G	probably damaging	Het
Aco1	A	T	4: 40,164,607		probably null	Het
Acp6	C	T	3: 97,165,885	R81W	probably damaging	Het
Agbl1	A	C	7: 76,589,381	Y543S	probably damaging	Het
Anapc7	T	C	5: 122,433,476	W205R	probably damaging	Het
Ap1g2	T	A	14: 55,101,429	M532L	probably damaging	Het
Appl1	A	G	14: 26,925,513		probably benign	Het
Arhgef19	T	C	4: 141,249,313	F462S	probably damaging	Het
Astn1	A	G	1: 158,505,316		probably null	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cadm2	T	C	16: 66,882,795	D50G	probably damaging	Het
Ccdc81	G	A	7: 89,882,294	Q324*	probably null	Het
Cd300lf	A	G	11: 115,120,380	V178A	probably benign	Het
Cdt1	T	C	8: 122,572,052	V476A	possibly damaging	Het
Cenpj	A	G	14: 56,558,725	V225A	probably benign	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Cfap54	A	G	10: 93,034,710	S684P	possibly damaging	Het
Clip1	C	A	5: 123,653,496	V204F	probably damaging	Het
Cnpy4	A	G	5: 138,192,840	E226G	probably benign	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Cpsf1	T	C	15: 76,602,156	M335V	probably benign	Het
Dnmt3b	C	A	2: 153,676,759	A614E	probably benign	Het
Dpm1	C	T	2: 168,217,735	R147Q	possibly damaging	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Engase	T	C	11: 118,478,933	F57S	probably damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gkn2	T	A	6: 87,378,155	Y115*	probably null	Het
Gtdc1	A	G	2: 44,591,914	S246P	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Herc2	C	T	7: 56,189,813	S3357L	possibly damaging	Het
Herc6	T	A	6: 57,662,075	Y840*	probably null	Het
Hoxa10	GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	6: 52,234,492		probably benign	Het
Ift122	T	C	6: 115,894,421		probably null	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Itgb2	A	T	10: 77,548,623	N193Y	possibly damaging	Het
Itgb5	T	G	16: 33,910,469	I65S	probably damaging	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Kcnt2	A	T	1: 140,584,293	H995L	probably damaging	Het
Kif7	T	C	7: 79,710,463	Y342C	probably damaging	Het
Klhl21	T	C	4: 152,015,420	V529A	possibly damaging	Het
Klhl26	T	C	8: 70,451,733	D475G	probably damaging	Het
Lcor	T	C	19: 41,559,128	Y384H	probably damaging	Het
Lrp1b	A	T	2: 40,919,167	C2463*	probably null	Het
March6	T	C	15: 31,459,193	E909G	possibly damaging	Het
Mrc1	A	T	2: 14,308,677		probably null	Het
Nipal4	T	A	11: 46,150,733	I212F	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Nwd2	A	G	5: 63,807,666	E1531G	possibly damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr204	T	G	16: 59,314,963	Y148S	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Opa1	T	C	16: 29,625,585	V863A	possibly damaging	Het
Pabpc4l	A	T	3: 46,446,363	M282K	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcnx3	T	C	19: 5,672,656	D1336G	probably damaging	Het
Phlpp1	T	C	1: 106,318,850	V590A	possibly damaging	Het
Rbck1	T	A	2: 152,318,356	T468S	probably damaging	Het
Ripor2	T	A	13: 24,693,887	I290N	probably damaging	Het
Rnf139	T	C	15: 58,899,497	L457P	probably damaging	Het
Rtn1	C	A	12: 72,304,410	A342S	possibly damaging	Het
Sema3d	A	G	5: 12,485,021		probably null	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Sez6l2	T	C	7: 126,953,496	V148A	probably damaging	Het
Shank2	C	A	7: 144,186,858	S568*	probably null	Het
Skiv2l2	T	C	13: 112,887,490	N707S	probably benign	Het
Slc10a4	T	C	5: 73,012,147	S372P	possibly damaging	Het
Slc10a5	T	C	3: 10,335,490	T37A	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Slc6a20b	G	T	9: 123,632,204	D52E	probably benign	Het
Slc6a5	T	C	7: 49,951,434	M661T	probably benign	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Steap4	G	T	5: 7,975,892	R151L	probably damaging	Het
Sun5	T	A	2: 153,865,995	I107L	probably benign	Het
Tacc1	C	T	8: 25,175,253	V488M	probably damaging	Het
Tgs1	A	G	4: 3,614,928	T829A	probably benign	Het
Tnxb	A	G	17: 34,695,825	E1929G	probably damaging	Het
Tssc4	A	C	7: 143,070,555	Q200P	probably damaging	Het
Ttn	A	G	2: 76,758,532	W21398R	probably damaging	Het
Usp50	C	T	2: 126,777,898		probably null	Het
Usp9y	A	T	Y: 1,448,829		probably null	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Zfat	T	C	15: 68,101,539	T1118A	probably benign	Het

Other mutations in Kif20b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Kif20b	APN	19	34947660	missense	possibly damaging	0.77
IGL01021:Kif20b	APN	19	34938260	missense	possibly damaging	0.89
IGL01590:Kif20b	APN	19	34954726	missense	possibly damaging	0.87
IGL01691:Kif20b	APN	19	34935743	splice site	probably benign
IGL01730:Kif20b	APN	19	34950523	nonsense	probably null
IGL02078:Kif20b	APN	19	34935644	missense	probably damaging	1.00
IGL02174:Kif20b	APN	19	34934458	splice site	probably benign
IGL02536:Kif20b	APN	19	34974559	missense	probably benign	0.42
IGL03029:Kif20b	APN	19	34950913	missense	probably benign
IGL03186:Kif20b	APN	19	34934944	missense	probably benign	0.45
IGL03205:Kif20b	APN	19	34959463	missense	probably damaging	1.00
IGL03493:Kif20b	APN	19	34959550	nonsense	probably null
R0319:Kif20b	UTSW	19	34947732	splice site	probably benign
R1069:Kif20b	UTSW	19	34950851	missense	probably damaging	1.00
R1137:Kif20b	UTSW	19	34937086	critical splice donor site	probably null
R1255:Kif20b	UTSW	19	34950106	missense	probably benign	0.08
R1352:Kif20b	UTSW	19	34924635	missense	probably benign
R1466:Kif20b	UTSW	19	34950599	missense	probably benign	0.00
R1466:Kif20b	UTSW	19	34950599	missense	probably benign	0.00
R1473:Kif20b	UTSW	19	34974496	missense	possibly damaging	0.93
R1545:Kif20b	UTSW	19	34928918	missense	probably damaging	1.00
R1647:Kif20b	UTSW	19	34936790	missense	possibly damaging	0.65
R1648:Kif20b	UTSW	19	34936790	missense	possibly damaging	0.65
R1752:Kif20b	UTSW	19	34938336	missense	probably benign	0.13
R1835:Kif20b	UTSW	19	34956038	missense	probably damaging	1.00
R1937:Kif20b	UTSW	19	34952878	missense	possibly damaging	0.73
R2112:Kif20b	UTSW	19	34931732	missense	probably benign	0.04
R2315:Kif20b	UTSW	19	34931599	missense	probably damaging	1.00
R2385:Kif20b	UTSW	19	34959419	missense	probably damaging	0.98
R2867:Kif20b	UTSW	19	34940128	missense	probably damaging	1.00
R2867:Kif20b	UTSW	19	34940128	missense	probably damaging	1.00
R3086:Kif20b	UTSW	19	34929715	missense	probably damaging	1.00
R3116:Kif20b	UTSW	19	34970080	missense	probably benign	0.38
R3407:Kif20b	UTSW	19	34950500	missense	probably damaging	1.00
R3834:Kif20b	UTSW	19	34935028	missense	probably damaging	1.00
R3882:Kif20b	UTSW	19	34950080	missense	probably damaging	1.00
R4698:Kif20b	UTSW	19	34951544	missense	probably damaging	1.00
R4721:Kif20b	UTSW	19	34938373	missense	probably benign	0.41
R4883:Kif20b	UTSW	19	34966122	missense	probably benign	0.00
R4901:Kif20b	UTSW	19	34934436	missense	probably benign	0.00
R4923:Kif20b	UTSW	19	34941211	critical splice acceptor site	probably null
R5538:Kif20b	UTSW	19	34952964	nonsense	probably null
R5540:Kif20b	UTSW	19	34938460	missense	probably benign	0.01
R5558:Kif20b	UTSW	19	34951549	missense	probably damaging	1.00
R5580:Kif20b	UTSW	19	34949728	splice site	probably null
R5934:Kif20b	UTSW	19	34941321	missense	probably benign	0.02
R6019:Kif20b	UTSW	19	34950464	missense	probably benign	0.00
R6464:Kif20b	UTSW	19	34934441	missense	probably benign
R6613:Kif20b	UTSW	19	34936984	nonsense	probably null
R6745:Kif20b	UTSW	19	34928876	missense	possibly damaging	0.94
R7097:Kif20b	UTSW	19	34974492	missense	probably damaging	0.98
R7237:Kif20b	UTSW	19	34950605	missense	probably damaging	1.00
R7260:Kif20b	UTSW	19	34950210	missense	probably damaging	1.00
R7373:Kif20b	UTSW	19	34935671	missense	probably damaging	1.00
R7418:Kif20b	UTSW	19	34929687	missense	probably damaging	0.99
R7814:Kif20b	UTSW	19	34950955	missense	possibly damaging	0.63
R7861:Kif20b	UTSW	19	34939922	missense	probably damaging	1.00
R8017:Kif20b	UTSW	19	34939879	missense	probably damaging	1.00
R8696:Kif20b	UTSW	19	34937352	missense	probably benign	0.02
R8724:Kif20b	UTSW	19	34938746	unclassified	probably benign
R8849:Kif20b	UTSW	19	34938316	nonsense	probably null
R8947:Kif20b	UTSW	19	34941229	missense	possibly damaging	0.46
R8998:Kif20b	UTSW	19	34936853	splice site	probably benign
R9017:Kif20b	UTSW	19	34949803	missense	probably benign	0.00
R9245:Kif20b	UTSW	19	34938325	missense	probably benign	0.02
R9613:Kif20b	UTSW	19	34942534	missense	possibly damaging	0.80
R9619:Kif20b	UTSW	19	34956029	missense	probably damaging	1.00
R9732:Kif20b	UTSW	19	34952953	missense	probably benign	0.18
R9746:Kif20b	UTSW	19	34950749	nonsense	probably null
Z1088:Kif20b	UTSW	19	34950451	missense	probably damaging	0.99
Z1176:Kif20b	UTSW	19	34952875	missense	probably benign	0.11
Z1177:Kif20b	UTSW	19	34950466	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTCCATATGAGATTGGAGGC -3'
(R):5'- GGTCACTACAGTTGCACAAATCC -3'

Sequencing Primer
(F):5'- TCCATATGAGATTGGAGGCATACTG -3'
(R):5'- TACTCACCAACAACAGCTTTTATG -3'

Posted On

2014-06-30