Mutagenetix > Incidental Mutations

Incidental Mutation 'R0119:Ap3d1'

20988

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

038405-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R0119 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 80723615 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

probably benign
Transcript: ENSMUST00000219356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	G	A	18: 70,469,482	Q87*	probably null	Het
Abca13	G	A	11: 9,298,076	E2608K	probably benign	Het
Acad9	T	C	3: 36,085,415	V388A	probably damaging	Het
Acpp	T	C	9: 104,320,002	E146G	probably damaging	Het
Adamts18	A	G	8: 113,774,953	I346T	possibly damaging	Het
Adcy8	T	A	15: 64,716,166	D894V	probably damaging	Het
Arg2	A	G	12: 79,147,612	D70G	probably damaging	Het
Cap1	A	T	4: 122,867,699	L130Q	probably damaging	Het
Carmil1	T	A	13: 24,082,020	N253I	probably damaging	Het
Caskin2	A	G	11: 115,802,427		probably benign	Het
Cd69	C	T	6: 129,270,062	S64N	probably benign	Het
Cd96	T	C	16: 46,038,579		probably benign	Het
Celf6	C	A	9: 59,602,878	T86K	probably benign	Het
Ces1c	A	T	8: 93,106,717		probably benign	Het
Ces1c	A	T	8: 93,107,610	L351M	probably benign	Het
Cnih3	T	A	1: 181,454,744		probably benign	Het
Col15a1	A	T	4: 47,262,950	D534V	probably damaging	Het
Cry1	A	G	10: 85,133,240		probably null	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Def8	G	A	8: 123,456,495	A278T	probably damaging	Het
Defb13	T	C	8: 21,946,861		probably benign	Het
Dnah1	C	T	14: 31,276,158	G2574D	probably damaging	Het
Dnah8	T	A	17: 30,715,509	F1489L	possibly damaging	Het
Elmo3	T	C	8: 105,309,768	L668S	probably damaging	Het
Elp2	T	C	18: 24,634,409	I716T	probably benign	Het
Fshr	C	G	17: 89,009,285	S169T	probably benign	Het
Gm6327	T	C	16: 12,761,197		noncoding transcript	Het
Gm839	A	T	6: 89,212,380		noncoding transcript	Het
Gng5	T	A	3: 146,503,293	C39S	probably damaging	Het
Gpr55	C	T	1: 85,941,424	W145*	probably null	Het
Hdlbp	A	C	1: 93,421,337		probably benign	Het
Man2a2	G	T	7: 80,367,405	N305K	probably damaging	Het
Me2	A	G	18: 73,770,673	S575P	probably benign	Het
Mier3	T	C	13: 111,715,038	V490A	probably damaging	Het
Mpdz	T	C	4: 81,292,531	T1693A	probably benign	Het
Mss51	T	A	14: 20,484,688	Q338L	possibly damaging	Het
Muc4	A	T	16: 32,750,195		probably benign	Het
Mug2	T	A	6: 122,036,063	H311Q	probably benign	Het
Neto1	G	A	18: 86,461,320	R211Q	probably benign	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Nisch	A	G	14: 31,171,924	Y1231H	probably damaging	Het
Obox3	T	A	7: 15,626,327		probably null	Het
Olfr394	C	T	11: 73,887,830	V181I	probably benign	Het
Optn	C	T	2: 5,024,115	G526R	probably damaging	Het
Pcdh15	T	C	10: 74,170,575	F95S	probably damaging	Het
Pcsk6	T	C	7: 66,039,043	V820A	probably benign	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Pdgfrb	T	A	18: 61,068,852	V496E	probably benign	Het
Per3	A	G	4: 151,024,548		probably benign	Het
Pip4k2b	A	T	11: 97,722,936		probably benign	Het
Podn	G	T	4: 108,021,594	L359I	probably damaging	Het
Rad21	A	T	15: 51,965,030	D547E	probably benign	Het
Rere	T	G	4: 150,615,322		probably benign	Het
Serpina1d	A	T	12: 103,765,757	L281Q	probably damaging	Het
Serpina9	T	C	12: 104,001,470	N222S	probably benign	Het
Sh3bgrl2	A	G	9: 83,577,559	K57E	probably damaging	Het
Sh3bgrl3	A	T	4: 134,128,036	I33N	probably damaging	Het
Sik3	T	C	9: 46,208,740	M659T	possibly damaging	Het
Sppl3	T	A	5: 115,088,994		probably benign	Het
Tacc2	C	A	7: 130,621,875	Q116K	probably damaging	Het
Tecta	T	C	9: 42,352,063	D1409G	probably damaging	Het
Tnpo3	A	G	6: 29,568,922	V477A	possibly damaging	Het
Trim7	G	T	11: 48,849,712	R212L	probably damaging	Het
Trpm6	T	A	19: 18,832,593	C1118S	probably benign	Het
Ugcg	G	C	4: 59,217,036	V187L	possibly damaging	Het
Vmn1r27	A	G	6: 58,215,719	F100S	possibly damaging	Het
Zbtb18	A	G	1: 177,448,157	E361G	probably benign	Het
Zzef1	T	C	11: 72,821,851	V199A	probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	intron	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GAAACAGAGCAGCCTCAGTCAGTG -3'
(R):5'- GTTGATGGAGACACCACCTTGGTAG -3'

Sequencing Primer
(F):5'- CAGCCTCAGTCAGTGAGACAAG -3'
(R):5'- ACACCACCTTGGTAGTAGAATG -3'

Posted On

2013-04-11