Incidental Mutation 'R1903:Tnc'
ID209905
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 039923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1903 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64000062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1204 (T1204K)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect probably benign
Transcript: ENSMUST00000030056
AA Change: T1204K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: T1204K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107372
AA Change: T1204K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: T1204K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107377
AA Change: T1204K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: T1204K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,258,352 S246R possibly damaging Het
Abca13 C T 11: 9,466,411 R4058C probably benign Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adam22 C T 5: 8,134,525 C489Y probably damaging Het
Agap3 A T 5: 24,493,013 K460I probably damaging Het
Ak4 T C 4: 101,463,636 I214T possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arrb2 T A 11: 70,437,982 H221Q probably damaging Het
Atl1 T G 12: 69,959,275 F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 T604A probably damaging Het
BC005561 T A 5: 104,518,330 S239R probably benign Het
Bglap3 T C 3: 88,368,761 I95V probably benign Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Ccnl1 A G 3: 65,946,911 S430P possibly damaging Het
Cdk5rap2 A T 4: 70,403,554 probably null Het
Cep126 A T 9: 8,120,747 Y92N possibly damaging Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnga1 T G 5: 72,616,725 D90A possibly damaging Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Coq3 T C 4: 21,910,466 S314P probably damaging Het
Crhr1 A G 11: 104,169,849 R151G probably damaging Het
Crybg2 A G 4: 134,078,856 I930V probably damaging Het
Ctcf T A 8: 105,675,988 probably null Het
Dct T C 14: 118,034,278 N380S probably benign Het
Decr2 A T 17: 26,087,413 L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dgkb T C 12: 38,166,777 probably null Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnajc13 A C 9: 104,228,937 L346R probably damaging Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
Duox2 T A 2: 122,295,351 I296F probably damaging Het
Ece2 T A 16: 20,645,172 L890H probably damaging Het
Ecsit A G 9: 22,076,519 S75P possibly damaging Het
Enpp3 A G 10: 24,778,789 C664R probably damaging Het
Evpl G T 11: 116,227,028 D778E probably damaging Het
Eya3 T A 4: 132,721,352 probably null Het
Fam217b A T 2: 178,420,581 I113F probably benign Het
Galnt6 G A 15: 100,716,118 P101S possibly damaging Het
Gm11487 T A 4: 73,403,438 Y120F probably damaging Het
Gm281 C T 14: 13,829,657 S695N possibly damaging Het
Gm379 G A X: 108,664,264 Q210* probably null Het
Grk4 A T 5: 34,676,187 probably null Het
Gtf3c4 A G 2: 28,839,956 V91A probably benign Het
Hcfc2 G T 10: 82,702,558 G143V probably damaging Het
Heatr4 A C 12: 83,958,447 H710Q probably damaging Het
Htr3a A T 9: 48,906,381 D97E probably damaging Het
Htr4 T G 18: 62,428,122 F151L probably benign Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Invs T A 4: 48,402,824 probably null Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irs1 T C 1: 82,289,461 S345G probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif26a C T 12: 112,175,540 R743C probably damaging Het
Kif28 A G 1: 179,702,523 V691A possibly damaging Het
Klhl5 T A 5: 65,166,987 L696Q probably benign Het
Krtap5-1 T C 7: 142,296,347 probably benign Het
Lama2 A C 10: 27,188,399 D1195E probably damaging Het
Lamb1 T G 12: 31,329,210 L1722R probably damaging Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Ltbp2 T C 12: 84,830,105 E422G probably benign Het
Man2b1 T A 8: 85,086,822 D214E probably damaging Het
Mlxipl A T 5: 135,133,568 D628V possibly damaging Het
Myo18b G A 5: 112,692,758 R2390C probably damaging Het
Mypn T A 10: 63,123,397 R1048S probably benign Het
Napepld A G 5: 21,665,272 S383P probably damaging Het
Napsa A G 7: 44,581,736 T130A probably damaging Het
Nbr1 T C 11: 101,575,152 I716T probably damaging Het
Nexn A T 3: 152,248,181 M212K probably damaging Het
Nlrp9b T A 7: 20,023,257 S140T probably benign Het
Nxpe2 T C 9: 48,319,606 T488A probably benign Het
Olfr1051 C T 2: 86,275,846 V214I probably benign Het
Olfr1420 A T 19: 11,896,549 Y176F probably benign Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr834 A T 9: 18,988,896 K303* probably null Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pan2 T G 10: 128,308,368 L162R probably damaging Het
Parp1 G T 1: 180,588,670 V545F probably damaging Het
Pcdh18 A G 3: 49,755,447 V473A probably benign Het
Plb1 A T 5: 32,291,238 N350I probably damaging Het
Polr1a A G 6: 71,967,914 K1318R probably benign Het
Ppp1r18 C T 17: 35,873,846 P130S probably damaging Het
Prss48 C T 3: 85,998,307 W86* probably null Het
Rab3c A T 13: 110,084,210 I137N probably damaging Het
Rab3gap2 G C 1: 185,221,902 R57P probably benign Het
Rad54l2 A C 9: 106,693,717 probably null Het
Ralgapb C A 2: 158,495,563 N1147K probably benign Het
Rfx7 C T 9: 72,616,811 R428C probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Shprh T A 10: 11,183,797 Y1097* probably null Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc24a4 T A 12: 102,131,617 D79E probably benign Het
Slc7a13 A T 4: 19,839,254 I286F probably benign Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Spata31d1b T C 13: 59,718,068 L1010P probably damaging Het
Sult2a1 T C 7: 13,835,975 S111G possibly damaging Het
Tecpr2 C T 12: 110,947,912 T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 M462T probably benign Het
Tmem171 C A 13: 98,686,416 G292* probably null Het
Tmtc2 G T 10: 105,190,108 T833N probably benign Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Tnrc18 G A 5: 142,815,140 S21F probably damaging Het
Tns4 T C 11: 99,075,575 T425A probably damaging Het
Tox T A 4: 6,688,948 Y472F probably damaging Het
Trak2 A T 1: 58,918,855 probably null Het
Trim33 T A 3: 103,337,444 Y716N probably damaging Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Ube2j2 A G 4: 155,949,026 K19R probably benign Het
Ubxn2b T C 4: 6,208,889 I206T possibly damaging Het
Usp40 A G 1: 87,982,056 F559L probably benign Het
Utp4 T A 8: 106,912,350 probably null Het
Vac14 A G 8: 110,682,534 N524S probably benign Het
Vps13c T C 9: 67,894,052 S605P probably damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zdhhc19 C T 16: 32,498,413 R28* probably null Het
Zfp106 T C 2: 120,526,848 I1189V probably benign Het
Zfp189 C T 4: 49,529,511 Q205* probably null Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 unclassified probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGGGATTCCTCTTAAGCAG -3'
(R):5'- CCCTTGGGTTCAGGATTTCC -3'

Sequencing Primer
(F):5'- TCTTAAGCAGAGACAGGGAGAG -3'
(R):5'- TGGGTTCAGGATTTCCTATATCTTAC -3'
Posted On2014-06-30