Incidental Mutation 'R1903:Cdk5rap2'
ID209906
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission 039923-MU
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R1903 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 70403554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126416
Predicted Effect probably null
Transcript: ENSMUST00000144099
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,258,352 S246R possibly damaging Het
Abca13 C T 11: 9,466,411 R4058C probably benign Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adam22 C T 5: 8,134,525 C489Y probably damaging Het
Agap3 A T 5: 24,493,013 K460I probably damaging Het
Ak4 T C 4: 101,463,636 I214T possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arrb2 T A 11: 70,437,982 H221Q probably damaging Het
Atl1 T G 12: 69,959,275 F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 T604A probably damaging Het
BC005561 T A 5: 104,518,330 S239R probably benign Het
Bglap3 T C 3: 88,368,761 I95V probably benign Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Ccnl1 A G 3: 65,946,911 S430P possibly damaging Het
Cep126 A T 9: 8,120,747 Y92N possibly damaging Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnga1 T G 5: 72,616,725 D90A possibly damaging Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Coq3 T C 4: 21,910,466 S314P probably damaging Het
Crhr1 A G 11: 104,169,849 R151G probably damaging Het
Crybg2 A G 4: 134,078,856 I930V probably damaging Het
Ctcf T A 8: 105,675,988 probably null Het
Dct T C 14: 118,034,278 N380S probably benign Het
Decr2 A T 17: 26,087,413 L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dgkb T C 12: 38,166,777 probably null Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnajc13 A C 9: 104,228,937 L346R probably damaging Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
Duox2 T A 2: 122,295,351 I296F probably damaging Het
Ece2 T A 16: 20,645,172 L890H probably damaging Het
Ecsit A G 9: 22,076,519 S75P possibly damaging Het
Enpp3 A G 10: 24,778,789 C664R probably damaging Het
Evpl G T 11: 116,227,028 D778E probably damaging Het
Eya3 T A 4: 132,721,352 probably null Het
Fam217b A T 2: 178,420,581 I113F probably benign Het
Galnt6 G A 15: 100,716,118 P101S possibly damaging Het
Gm11487 T A 4: 73,403,438 Y120F probably damaging Het
Gm281 C T 14: 13,829,657 S695N possibly damaging Het
Gm379 G A X: 108,664,264 Q210* probably null Het
Grk4 A T 5: 34,676,187 probably null Het
Gtf3c4 A G 2: 28,839,956 V91A probably benign Het
Hcfc2 G T 10: 82,702,558 G143V probably damaging Het
Heatr4 A C 12: 83,958,447 H710Q probably damaging Het
Htr3a A T 9: 48,906,381 D97E probably damaging Het
Htr4 T G 18: 62,428,122 F151L probably benign Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Invs T A 4: 48,402,824 probably null Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irs1 T C 1: 82,289,461 S345G probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif26a C T 12: 112,175,540 R743C probably damaging Het
Kif28 A G 1: 179,702,523 V691A possibly damaging Het
Klhl5 T A 5: 65,166,987 L696Q probably benign Het
Krtap5-1 T C 7: 142,296,347 probably benign Het
Lama2 A C 10: 27,188,399 D1195E probably damaging Het
Lamb1 T G 12: 31,329,210 L1722R probably damaging Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Ltbp2 T C 12: 84,830,105 E422G probably benign Het
Man2b1 T A 8: 85,086,822 D214E probably damaging Het
Mlxipl A T 5: 135,133,568 D628V possibly damaging Het
Myo18b G A 5: 112,692,758 R2390C probably damaging Het
Mypn T A 10: 63,123,397 R1048S probably benign Het
Napepld A G 5: 21,665,272 S383P probably damaging Het
Napsa A G 7: 44,581,736 T130A probably damaging Het
Nbr1 T C 11: 101,575,152 I716T probably damaging Het
Nexn A T 3: 152,248,181 M212K probably damaging Het
Nlrp9b T A 7: 20,023,257 S140T probably benign Het
Nxpe2 T C 9: 48,319,606 T488A probably benign Het
Olfr1051 C T 2: 86,275,846 V214I probably benign Het
Olfr1420 A T 19: 11,896,549 Y176F probably benign Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr834 A T 9: 18,988,896 K303* probably null Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pan2 T G 10: 128,308,368 L162R probably damaging Het
Parp1 G T 1: 180,588,670 V545F probably damaging Het
Pcdh18 A G 3: 49,755,447 V473A probably benign Het
Plb1 A T 5: 32,291,238 N350I probably damaging Het
Polr1a A G 6: 71,967,914 K1318R probably benign Het
Ppp1r18 C T 17: 35,873,846 P130S probably damaging Het
Prss48 C T 3: 85,998,307 W86* probably null Het
Rab3c A T 13: 110,084,210 I137N probably damaging Het
Rab3gap2 G C 1: 185,221,902 R57P probably benign Het
Rad54l2 A C 9: 106,693,717 probably null Het
Ralgapb C A 2: 158,495,563 N1147K probably benign Het
Rfx7 C T 9: 72,616,811 R428C probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Shprh T A 10: 11,183,797 Y1097* probably null Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc24a4 T A 12: 102,131,617 D79E probably benign Het
Slc7a13 A T 4: 19,839,254 I286F probably benign Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Spata31d1b T C 13: 59,718,068 L1010P probably damaging Het
Sult2a1 T C 7: 13,835,975 S111G possibly damaging Het
Tecpr2 C T 12: 110,947,912 T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 M462T probably benign Het
Tmem171 C A 13: 98,686,416 G292* probably null Het
Tmtc2 G T 10: 105,190,108 T833N probably benign Het
Tnc G T 4: 64,000,062 T1204K probably benign Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Tnrc18 G A 5: 142,815,140 S21F probably damaging Het
Tns4 T C 11: 99,075,575 T425A probably damaging Het
Tox T A 4: 6,688,948 Y472F probably damaging Het
Trak2 A T 1: 58,918,855 probably null Het
Trim33 T A 3: 103,337,444 Y716N probably damaging Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Ube2j2 A G 4: 155,949,026 K19R probably benign Het
Ubxn2b T C 4: 6,208,889 I206T possibly damaging Het
Usp40 A G 1: 87,982,056 F559L probably benign Het
Utp4 T A 8: 106,912,350 probably null Het
Vac14 A G 8: 110,682,534 N524S probably benign Het
Vps13c T C 9: 67,894,052 S605P probably damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zdhhc19 C T 16: 32,498,413 R28* probably null Het
Zfp106 T C 2: 120,526,848 I1189V probably benign Het
Zfp189 C T 4: 49,529,511 Q205* probably null Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 intron probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACACGATGTGTACAAGATGCTG -3'
(R):5'- AAGGCAGTTCTAAAGCTCGAG -3'

Sequencing Primer
(F):5'- CTGAGCATGCACTGTGTGTC -3'
(R):5'- TGACCGTTTCATGAGGTC -3'
Posted On2014-06-30