Incidental Mutation 'R1903:Adam22'
ID209916
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 039923-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1903 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8134525 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 489 (C489Y)
Ref Sequence ENSEMBL: ENSMUSP00000111046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388]
Predicted Effect probably damaging
Transcript: ENSMUST00000046838
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050166
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088744
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088761
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115386
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115388
AA Change: C489Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: C489Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,258,352 S246R possibly damaging Het
Abca13 C T 11: 9,466,411 R4058C probably benign Het
Acacb A T 5: 114,165,734 R73* probably null Het
Agap3 A T 5: 24,493,013 K460I probably damaging Het
Ak4 T C 4: 101,463,636 I214T possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arrb2 T A 11: 70,437,982 H221Q probably damaging Het
Atl1 T G 12: 69,959,275 F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 T604A probably damaging Het
BC005561 T A 5: 104,518,330 S239R probably benign Het
Bglap3 T C 3: 88,368,761 I95V probably benign Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Ccnl1 A G 3: 65,946,911 S430P possibly damaging Het
Cdk5rap2 A T 4: 70,403,554 probably null Het
Cep126 A T 9: 8,120,747 Y92N possibly damaging Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnga1 T G 5: 72,616,725 D90A possibly damaging Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Coq3 T C 4: 21,910,466 S314P probably damaging Het
Crhr1 A G 11: 104,169,849 R151G probably damaging Het
Crybg2 A G 4: 134,078,856 I930V probably damaging Het
Ctcf T A 8: 105,675,988 probably null Het
Dct T C 14: 118,034,278 N380S probably benign Het
Decr2 A T 17: 26,087,413 L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dgkb T C 12: 38,166,777 probably null Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnajc13 A C 9: 104,228,937 L346R probably damaging Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
Duox2 T A 2: 122,295,351 I296F probably damaging Het
Ece2 T A 16: 20,645,172 L890H probably damaging Het
Ecsit A G 9: 22,076,519 S75P possibly damaging Het
Enpp3 A G 10: 24,778,789 C664R probably damaging Het
Evpl G T 11: 116,227,028 D778E probably damaging Het
Eya3 T A 4: 132,721,352 probably null Het
Fam217b A T 2: 178,420,581 I113F probably benign Het
Galnt6 G A 15: 100,716,118 P101S possibly damaging Het
Gm11487 T A 4: 73,403,438 Y120F probably damaging Het
Gm281 C T 14: 13,829,657 S695N possibly damaging Het
Gm379 G A X: 108,664,264 Q210* probably null Het
Grk4 A T 5: 34,676,187 probably null Het
Gtf3c4 A G 2: 28,839,956 V91A probably benign Het
Hcfc2 G T 10: 82,702,558 G143V probably damaging Het
Heatr4 A C 12: 83,958,447 H710Q probably damaging Het
Htr3a A T 9: 48,906,381 D97E probably damaging Het
Htr4 T G 18: 62,428,122 F151L probably benign Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Invs T A 4: 48,402,824 probably null Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irs1 T C 1: 82,289,461 S345G probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif26a C T 12: 112,175,540 R743C probably damaging Het
Kif28 A G 1: 179,702,523 V691A possibly damaging Het
Klhl5 T A 5: 65,166,987 L696Q probably benign Het
Krtap5-1 T C 7: 142,296,347 probably benign Het
Lama2 A C 10: 27,188,399 D1195E probably damaging Het
Lamb1 T G 12: 31,329,210 L1722R probably damaging Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Ltbp2 T C 12: 84,830,105 E422G probably benign Het
Man2b1 T A 8: 85,086,822 D214E probably damaging Het
Mlxipl A T 5: 135,133,568 D628V possibly damaging Het
Myo18b G A 5: 112,692,758 R2390C probably damaging Het
Mypn T A 10: 63,123,397 R1048S probably benign Het
Napepld A G 5: 21,665,272 S383P probably damaging Het
Napsa A G 7: 44,581,736 T130A probably damaging Het
Nbr1 T C 11: 101,575,152 I716T probably damaging Het
Nexn A T 3: 152,248,181 M212K probably damaging Het
Nlrp9b T A 7: 20,023,257 S140T probably benign Het
Nxpe2 T C 9: 48,319,606 T488A probably benign Het
Olfr1051 C T 2: 86,275,846 V214I probably benign Het
Olfr1420 A T 19: 11,896,549 Y176F probably benign Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr834 A T 9: 18,988,896 K303* probably null Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pan2 T G 10: 128,308,368 L162R probably damaging Het
Parp1 G T 1: 180,588,670 V545F probably damaging Het
Pcdh18 A G 3: 49,755,447 V473A probably benign Het
Plb1 A T 5: 32,291,238 N350I probably damaging Het
Polr1a A G 6: 71,967,914 K1318R probably benign Het
Ppp1r18 C T 17: 35,873,846 P130S probably damaging Het
Prss48 C T 3: 85,998,307 W86* probably null Het
Rab3c A T 13: 110,084,210 I137N probably damaging Het
Rab3gap2 G C 1: 185,221,902 R57P probably benign Het
Rad54l2 A C 9: 106,693,717 probably null Het
Ralgapb C A 2: 158,495,563 N1147K probably benign Het
Rfx7 C T 9: 72,616,811 R428C probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Shprh T A 10: 11,183,797 Y1097* probably null Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc24a4 T A 12: 102,131,617 D79E probably benign Het
Slc7a13 A T 4: 19,839,254 I286F probably benign Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Spata31d1b T C 13: 59,718,068 L1010P probably damaging Het
Sult2a1 T C 7: 13,835,975 S111G possibly damaging Het
Tecpr2 C T 12: 110,947,912 T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 M462T probably benign Het
Tmem171 C A 13: 98,686,416 G292* probably null Het
Tmtc2 G T 10: 105,190,108 T833N probably benign Het
Tnc G T 4: 64,000,062 T1204K probably benign Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Tnrc18 G A 5: 142,815,140 S21F probably damaging Het
Tns4 T C 11: 99,075,575 T425A probably damaging Het
Tox T A 4: 6,688,948 Y472F probably damaging Het
Trak2 A T 1: 58,918,855 probably null Het
Trim33 T A 3: 103,337,444 Y716N probably damaging Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Ube2j2 A G 4: 155,949,026 K19R probably benign Het
Ubxn2b T C 4: 6,208,889 I206T possibly damaging Het
Usp40 A G 1: 87,982,056 F559L probably benign Het
Utp4 T A 8: 106,912,350 probably null Het
Vac14 A G 8: 110,682,534 N524S probably benign Het
Vps13c T C 9: 67,894,052 S605P probably damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zdhhc19 C T 16: 32,498,413 R28* probably null Het
Zfp106 T C 2: 120,526,848 I1189V probably benign Het
Zfp189 C T 4: 49,529,511 Q205* probably null Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
R7402:Adam22 UTSW 5 8095049 missense possibly damaging 0.95
R7431:Adam22 UTSW 5 8092818 missense probably damaging 1.00
R7527:Adam22 UTSW 5 8082239 missense possibly damaging 0.66
R7571:Adam22 UTSW 5 8082160 nonsense probably null
R7627:Adam22 UTSW 5 8367933 missense probably benign
R7714:Adam22 UTSW 5 8117587 critical splice donor site probably null
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCGCACTTCAGAAGACTTC -3'
(R):5'- TCTCGAGATAGTATGGAGCATTAC -3'

Sequencing Primer
(F):5'- CTTCAGAAGACTTCAGGAGGCTC -3'
(R):5'- GAAATTTTACAGGATTTGTGGATGC -3'
Posted On2014-06-30