Incidental Mutation 'R0119:Olfr394'
ID20993
Institutional Source Beutler Lab
Gene Symbol Olfr394
Ensembl Gene ENSMUSG00000056921
Gene Nameolfactory receptor 394
SynonymsMOR135-8, GA_x6K02T2P1NL-4043306-4042374
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location73883337-73890771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73887830 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 181 (V181I)
Ref Sequence ENSEMBL: ENSMUSP00000149527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071478] [ENSMUST00000214284] [ENSMUST00000216608]
Predicted Effect probably benign
Transcript: ENSMUST00000071478
AA Change: V181I

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071415
Gene: ENSMUSG00000056921
AA Change: V181I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4e-7 PFAM
Pfam:7tm_1 39 288 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214284
AA Change: V181I

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216608
AA Change: V181I

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Olfr394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr394 APN 11 73888249 missense probably damaging 1.00
IGL01655:Olfr394 APN 11 73887927 missense probably benign 0.01
IGL02173:Olfr394 APN 11 73888123 missense possibly damaging 0.72
IGL02308:Olfr394 APN 11 73888295 missense probably benign 0.09
IGL02656:Olfr394 APN 11 73888039 missense probably damaging 0.98
R0079:Olfr394 UTSW 11 73887737 missense probably benign 0.22
R0136:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0136:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0255:Olfr394 UTSW 11 73887829 missense probably benign
R0545:Olfr394 UTSW 11 73888017 nonsense probably null
R0599:Olfr394 UTSW 11 73887904 missense probably benign 0.19
R0655:Olfr394 UTSW 11 73887805 missense possibly damaging 0.88
R0657:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0657:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0720:Olfr394 UTSW 11 73887862 missense probably benign 0.12
R1112:Olfr394 UTSW 11 73888234 missense probably damaging 0.99
R2353:Olfr394 UTSW 11 73887834 missense probably benign 0.02
R2924:Olfr394 UTSW 11 73887511 missense probably damaging 0.99
R4583:Olfr394 UTSW 11 73887803 missense probably damaging 1.00
R5231:Olfr394 UTSW 11 73887955 missense probably damaging 1.00
R5537:Olfr394 UTSW 11 73887697 missense probably benign 0.02
R5806:Olfr394 UTSW 11 73887547 missense probably damaging 0.99
R7131:Olfr394 UTSW 11 73887954 nonsense probably null
R7325:Olfr394 UTSW 11 73888275 missense probably benign 0.19
R7361:Olfr394 UTSW 11 73888001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGCCTTGAGTAGATGGAACC -3'
(R):5'- CTCTGTCACAATGCCCAAATTGCTG -3'

Sequencing Primer
(F):5'- CCTTGAGTAGATGGAACCTTAAGAG -3'
(R):5'- GAGGTTGCCTGGCACAAATATTC -3'
Posted On2013-04-11