Incidental Mutation 'R1903:Trrap'
ID 209930
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Name transformation/transcription domain-associated protein
Synonyms transactivation/transformation-domain associated protein
MMRRC Submission 039923-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1903 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 144704547-144796588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 144752863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 1813 (I1813R)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038980
AA Change: I1794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: I1794R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094120
AA Change: I1812R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: I1812R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100467
AA Change: I1794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: I1794R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect unknown
Transcript: ENSMUST00000132925
AA Change: I1533R
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: I1533R

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143357
Predicted Effect probably damaging
Transcript: ENSMUST00000213013
AA Change: I1813R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197834
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,165,635 (GRCm39) S246R possibly damaging Het
Abca13 C T 11: 9,416,411 (GRCm39) R4058C probably benign Het
Acacb A T 5: 114,303,795 (GRCm39) R73* probably null Het
Adam22 C T 5: 8,184,525 (GRCm39) C489Y probably damaging Het
Agap3 A T 5: 24,698,011 (GRCm39) K460I probably damaging Het
Ak4 T C 4: 101,320,833 (GRCm39) I214T possibly damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arrb2 T A 11: 70,328,808 (GRCm39) H221Q probably damaging Het
Atl1 T G 12: 70,006,049 (GRCm39) F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 (GRCm39) T604A probably damaging Het
Bglap3 T C 3: 88,276,068 (GRCm39) I95V probably benign Het
Ccdc88a G T 11: 29,411,788 (GRCm39) M532I probably benign Het
Ccnl1 A G 3: 65,854,332 (GRCm39) S430P possibly damaging Het
Cdhr18 C T 14: 13,829,657 (GRCm38) S695N possibly damaging Het
Cdk5rap2 A T 4: 70,321,791 (GRCm39) probably null Het
Cep126 A T 9: 8,120,748 (GRCm39) Y92N possibly damaging Het
Cfap44 A C 16: 44,242,737 (GRCm39) T714P probably benign Het
Cnga1 T G 5: 72,774,068 (GRCm39) D90A possibly damaging Het
Cnot1 T C 8: 96,469,749 (GRCm39) I1369V possibly damaging Het
Coq3 T C 4: 21,910,466 (GRCm39) S314P probably damaging Het
Crhr1 A G 11: 104,060,675 (GRCm39) R151G probably damaging Het
Crybg2 A G 4: 133,806,167 (GRCm39) I930V probably damaging Het
Ctcf T A 8: 106,402,620 (GRCm39) probably null Het
Dct T C 14: 118,271,690 (GRCm39) N380S probably benign Het
Decr2 A T 17: 26,306,387 (GRCm39) L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 33,067,751 (GRCm39) probably benign Het
Dgkb T C 12: 38,216,776 (GRCm39) probably null Het
Dnah1 T C 14: 31,041,716 (GRCm39) D85G probably damaging Het
Dnah7a T C 1: 53,574,637 (GRCm39) D1709G probably damaging Het
Dnajc13 A C 9: 104,106,136 (GRCm39) L346R probably damaging Het
Dsc1 A T 18: 20,229,045 (GRCm39) V415D probably damaging Het
Duox2 T A 2: 122,125,832 (GRCm39) I296F probably damaging Het
Ece2 T A 16: 20,463,922 (GRCm39) L890H probably damaging Het
Ecsit A G 9: 21,987,815 (GRCm39) S75P possibly damaging Het
Enpp3 A G 10: 24,654,687 (GRCm39) C664R probably damaging Het
Evpl G T 11: 116,117,854 (GRCm39) D778E probably damaging Het
Eya3 T A 4: 132,448,663 (GRCm39) probably null Het
Fam217b A T 2: 178,062,374 (GRCm39) I113F probably benign Het
Galnt6 G A 15: 100,613,999 (GRCm39) P101S possibly damaging Het
Gm379 G A X: 107,707,870 (GRCm39) Q210* probably null Het
Grk4 A T 5: 34,833,531 (GRCm39) probably null Het
Gtf3c4 A G 2: 28,729,968 (GRCm39) V91A probably benign Het
Hcfc2 G T 10: 82,538,392 (GRCm39) G143V probably damaging Het
Heatr4 A C 12: 84,005,221 (GRCm39) H710Q probably damaging Het
Htr3a A T 9: 48,817,681 (GRCm39) D97E probably damaging Het
Htr4 T G 18: 62,561,193 (GRCm39) F151L probably benign Het
Il22ra1 A T 4: 135,478,219 (GRCm39) Q430L probably damaging Het
Invs T A 4: 48,402,824 (GRCm39) probably null Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Irs1 T C 1: 82,267,182 (GRCm39) S345G probably damaging Het
Kdm4a A G 4: 118,017,596 (GRCm39) V490A probably benign Het
Kif26a C T 12: 112,141,974 (GRCm39) R743C probably damaging Het
Kif28 A G 1: 179,530,088 (GRCm39) V691A possibly damaging Het
Klhl5 T A 5: 65,324,330 (GRCm39) L696Q probably benign Het
Krtap5-1 T C 7: 141,850,084 (GRCm39) probably benign Het
Lama2 A C 10: 27,064,395 (GRCm39) D1195E probably damaging Het
Lamb1 T G 12: 31,379,209 (GRCm39) L1722R probably damaging Het
Lrp11 T A 10: 7,499,544 (GRCm39) L245Q probably damaging Het
Ltbp2 T C 12: 84,876,879 (GRCm39) E422G probably benign Het
Man2b1 T A 8: 85,813,451 (GRCm39) D214E probably damaging Het
Mlxipl A T 5: 135,162,422 (GRCm39) D628V possibly damaging Het
Msantd5f6 T A 4: 73,321,675 (GRCm39) Y120F probably damaging Het
Myo18b G A 5: 112,840,624 (GRCm39) R2390C probably damaging Het
Mypn T A 10: 62,959,176 (GRCm39) R1048S probably benign Het
Napepld A G 5: 21,870,270 (GRCm39) S383P probably damaging Het
Napsa A G 7: 44,231,160 (GRCm39) T130A probably damaging Het
Nbr1 T C 11: 101,465,978 (GRCm39) I716T probably damaging Het
Nexn A T 3: 151,953,818 (GRCm39) M212K probably damaging Het
Nlrp9b T A 7: 19,757,182 (GRCm39) S140T probably benign Het
Nxpe2 T C 9: 48,230,906 (GRCm39) T488A probably benign Het
Or10g3 T G 14: 52,610,174 (GRCm39) Q112P possibly damaging Het
Or10v1 A T 19: 11,873,913 (GRCm39) Y176F probably benign Het
Or5ac25 A T 16: 59,182,526 (GRCm39) D18E probably benign Het
Or7g12 A T 9: 18,900,192 (GRCm39) K303* probably null Het
Or8k20 C T 2: 86,106,190 (GRCm39) V214I probably benign Het
Osbpl5 T C 7: 143,256,918 (GRCm39) D404G possibly damaging Het
Pan2 T G 10: 128,144,237 (GRCm39) L162R probably damaging Het
Parp1 G T 1: 180,416,235 (GRCm39) V545F probably damaging Het
Pcdh18 A G 3: 49,709,896 (GRCm39) V473A probably benign Het
Plb1 A T 5: 32,448,582 (GRCm39) N350I probably damaging Het
Polr1a A G 6: 71,944,898 (GRCm39) K1318R probably benign Het
Ppp1r18 C T 17: 36,184,738 (GRCm39) P130S probably damaging Het
Prss48 C T 3: 85,905,614 (GRCm39) W86* probably null Het
Rab3c A T 13: 110,220,744 (GRCm39) I137N probably damaging Het
Rab3gap2 G C 1: 184,954,099 (GRCm39) R57P probably benign Het
Rad54l2 A C 9: 106,570,916 (GRCm39) probably null Het
Ralgapb C A 2: 158,337,483 (GRCm39) N1147K probably benign Het
Rfx7 C T 9: 72,524,093 (GRCm39) R428C probably damaging Het
Robo1 A G 16: 72,757,092 (GRCm39) Q351R probably null Het
Samd4 T C 14: 47,311,585 (GRCm39) F81S probably damaging Het
Shprh T A 10: 11,059,541 (GRCm39) Y1097* probably null Het
Sik3 C G 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Slc24a4 T A 12: 102,097,876 (GRCm39) D79E probably benign Het
Slc7a13 A T 4: 19,839,254 (GRCm39) I286F probably benign Het
Smarca1 G A X: 46,938,840 (GRCm39) Q723* probably null Het
Spata31d1b T C 13: 59,865,882 (GRCm39) L1010P probably damaging Het
Sult2a1 T C 7: 13,569,900 (GRCm39) S111G possibly damaging Het
Tecpr2 C T 12: 110,914,346 (GRCm39) T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 (GRCm39) M462T probably benign Het
Thoc2l T A 5: 104,666,196 (GRCm39) S239R probably benign Het
Tmem171 C A 13: 98,822,924 (GRCm39) G292* probably null Het
Tmtc2 G T 10: 105,025,969 (GRCm39) T833N probably benign Het
Tnc G T 4: 63,918,299 (GRCm39) T1204K probably benign Het
Tnfaip3 T C 10: 18,883,937 (GRCm39) K148E probably benign Het
Tnrc18 G A 5: 142,800,895 (GRCm39) S21F probably damaging Het
Tns4 T C 11: 98,966,401 (GRCm39) T425A probably damaging Het
Tox T A 4: 6,688,948 (GRCm39) Y472F probably damaging Het
Trak2 A T 1: 58,958,014 (GRCm39) probably null Het
Trim33 T A 3: 103,244,760 (GRCm39) Y716N probably damaging Het
Ttc29 A G 8: 78,978,361 (GRCm39) E137G probably benign Het
Ube2j2 A G 4: 156,033,483 (GRCm39) K19R probably benign Het
Ubxn2b T C 4: 6,208,889 (GRCm39) I206T possibly damaging Het
Usp40 A G 1: 87,909,778 (GRCm39) F559L probably benign Het
Utp4 T A 8: 107,638,982 (GRCm39) probably null Het
Vac14 A G 8: 111,409,166 (GRCm39) N524S probably benign Het
Vps13c T C 9: 67,801,334 (GRCm39) S605P probably damaging Het
Vwa5b2 G T 16: 20,423,582 (GRCm39) S1165I possibly damaging Het
Zdhhc19 C T 16: 32,317,231 (GRCm39) R28* probably null Het
Zfp106 T C 2: 120,357,329 (GRCm39) I1189V probably benign Het
Zfp189 C T 4: 49,529,511 (GRCm39) Q205* probably null Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144,716,784 (GRCm39) splice site probably benign
IGL00470:Trrap APN 5 144,754,848 (GRCm39) missense probably damaging 1.00
IGL00490:Trrap APN 5 144,762,035 (GRCm39) missense probably benign 0.40
IGL01072:Trrap APN 5 144,721,065 (GRCm39) splice site probably benign
IGL01087:Trrap APN 5 144,783,349 (GRCm39) missense probably damaging 0.99
IGL01300:Trrap APN 5 144,741,628 (GRCm39) missense probably damaging 1.00
IGL01350:Trrap APN 5 144,767,779 (GRCm39) missense possibly damaging 0.92
IGL01410:Trrap APN 5 144,767,831 (GRCm39) missense probably benign 0.00
IGL01571:Trrap APN 5 144,770,097 (GRCm39) splice site probably benign
IGL01748:Trrap APN 5 144,770,150 (GRCm39) missense probably damaging 1.00
IGL01839:Trrap APN 5 144,758,685 (GRCm39) missense probably damaging 1.00
IGL01976:Trrap APN 5 144,793,799 (GRCm39) missense probably benign 0.00
IGL02075:Trrap APN 5 144,765,304 (GRCm39) missense probably benign 0.00
IGL02127:Trrap APN 5 144,753,243 (GRCm39) missense probably benign 0.22
IGL02131:Trrap APN 5 144,777,246 (GRCm39) missense probably damaging 1.00
IGL02287:Trrap APN 5 144,769,348 (GRCm39) missense probably damaging 1.00
IGL02301:Trrap APN 5 144,714,727 (GRCm39) missense probably benign 0.05
IGL02336:Trrap APN 5 144,735,200 (GRCm39) missense probably benign 0.39
IGL02526:Trrap APN 5 144,761,360 (GRCm39) missense probably benign 0.00
IGL02873:Trrap APN 5 144,777,889 (GRCm39) splice site probably benign
IGL02953:Trrap APN 5 144,752,774 (GRCm39) missense probably damaging 0.99
IGL03404:Trrap APN 5 144,769,996 (GRCm39) missense probably benign 0.00
Buffer UTSW 5 144,771,014 (GRCm39) missense probably benign 0.06
Card-tower UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
Cookie UTSW 5 144,730,859 (GRCm39) missense probably damaging 1.00
Glass_house UTSW 5 144,782,287 (GRCm39) missense possibly damaging 0.67
Immovable UTSW 5 144,727,665 (GRCm39) missense possibly damaging 0.66
R5049_trrap_520 UTSW 5 144,763,527 (GRCm39) missense probably damaging 1.00
R7167_Trrap_977 UTSW 5 144,776,424 (GRCm39) missense probably benign 0.39
vitreous UTSW 5 144,742,537 (GRCm39) missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144,733,781 (GRCm39) missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144,765,410 (GRCm39) missense probably benign 0.02
R0062:Trrap UTSW 5 144,719,003 (GRCm39) splice site probably benign
R0062:Trrap UTSW 5 144,719,003 (GRCm39) splice site probably benign
R0112:Trrap UTSW 5 144,759,571 (GRCm39) nonsense probably null
R0126:Trrap UTSW 5 144,742,560 (GRCm39) nonsense probably null
R0257:Trrap UTSW 5 144,741,045 (GRCm39) missense probably benign 0.31
R0325:Trrap UTSW 5 144,753,205 (GRCm39) missense probably benign 0.05
R0376:Trrap UTSW 5 144,753,149 (GRCm39) missense probably benign 0.03
R0396:Trrap UTSW 5 144,751,366 (GRCm39) missense probably damaging 0.99
R0448:Trrap UTSW 5 144,776,377 (GRCm39) missense possibly damaging 0.66
R0454:Trrap UTSW 5 144,783,287 (GRCm39) missense probably damaging 1.00
R0711:Trrap UTSW 5 144,790,309 (GRCm39) missense probably damaging 1.00
R0827:Trrap UTSW 5 144,751,640 (GRCm39) missense probably benign 0.00
R1005:Trrap UTSW 5 144,742,537 (GRCm39) missense probably damaging 1.00
R1147:Trrap UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
R1147:Trrap UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
R1179:Trrap UTSW 5 144,714,749 (GRCm39) missense possibly damaging 0.94
R1218:Trrap UTSW 5 144,753,219 (GRCm39) missense probably damaging 1.00
R1264:Trrap UTSW 5 144,726,409 (GRCm39) splice site probably benign
R1374:Trrap UTSW 5 144,783,428 (GRCm39) missense probably damaging 1.00
R1401:Trrap UTSW 5 144,794,232 (GRCm39) missense possibly damaging 0.93
R1480:Trrap UTSW 5 144,755,123 (GRCm39) missense probably benign
R1538:Trrap UTSW 5 144,774,012 (GRCm39) missense possibly damaging 0.65
R1751:Trrap UTSW 5 144,751,385 (GRCm39) critical splice donor site probably null
R1779:Trrap UTSW 5 144,765,400 (GRCm39) missense probably benign 0.01
R1782:Trrap UTSW 5 144,759,513 (GRCm39) missense possibly damaging 0.93
R1792:Trrap UTSW 5 144,790,396 (GRCm39) missense possibly damaging 0.87
R1859:Trrap UTSW 5 144,767,761 (GRCm39) missense probably benign 0.04
R1861:Trrap UTSW 5 144,752,727 (GRCm39) splice site probably null
R1902:Trrap UTSW 5 144,752,863 (GRCm39) missense probably damaging 1.00
R2021:Trrap UTSW 5 144,790,298 (GRCm39) missense possibly damaging 0.94
R2026:Trrap UTSW 5 144,739,854 (GRCm39) missense possibly damaging 0.86
R2036:Trrap UTSW 5 144,765,372 (GRCm39) missense probably benign 0.08
R2099:Trrap UTSW 5 144,719,049 (GRCm39) missense possibly damaging 0.46
R2108:Trrap UTSW 5 144,762,684 (GRCm39) missense probably benign 0.01
R2113:Trrap UTSW 5 144,781,021 (GRCm39) missense probably damaging 1.00
R2174:Trrap UTSW 5 144,758,665 (GRCm39) missense probably benign 0.40
R2442:Trrap UTSW 5 144,754,776 (GRCm39) missense probably damaging 1.00
R2568:Trrap UTSW 5 144,780,179 (GRCm39) critical splice donor site probably null
R3442:Trrap UTSW 5 144,729,062 (GRCm39) missense probably benign 0.03
R3853:Trrap UTSW 5 144,728,975 (GRCm39) missense probably damaging 1.00
R4401:Trrap UTSW 5 144,780,128 (GRCm39) missense possibly damaging 0.60
R4493:Trrap UTSW 5 144,767,858 (GRCm39) missense probably benign 0.21
R4524:Trrap UTSW 5 144,762,131 (GRCm39) missense probably benign 0.38
R4569:Trrap UTSW 5 144,728,928 (GRCm39) missense probably benign 0.13
R4672:Trrap UTSW 5 144,722,290 (GRCm39) missense probably damaging 0.97
R4732:Trrap UTSW 5 144,753,380 (GRCm39) missense probably damaging 1.00
R4733:Trrap UTSW 5 144,753,380 (GRCm39) missense probably damaging 1.00
R4791:Trrap UTSW 5 144,740,087 (GRCm39) missense probably damaging 1.00
R4795:Trrap UTSW 5 144,769,298 (GRCm39) missense probably benign 0.06
R4827:Trrap UTSW 5 144,737,758 (GRCm39) missense probably benign 0.02
R4839:Trrap UTSW 5 144,782,402 (GRCm39) missense probably damaging 1.00
R4915:Trrap UTSW 5 144,742,545 (GRCm39) missense probably damaging 0.99
R4951:Trrap UTSW 5 144,742,530 (GRCm39) missense possibly damaging 0.65
R4959:Trrap UTSW 5 144,793,770 (GRCm39) missense probably damaging 1.00
R5049:Trrap UTSW 5 144,763,527 (GRCm39) missense probably damaging 1.00
R5074:Trrap UTSW 5 144,787,989 (GRCm39) missense probably damaging 1.00
R5236:Trrap UTSW 5 144,754,596 (GRCm39) missense probably benign 0.07
R5281:Trrap UTSW 5 144,750,313 (GRCm39) missense probably benign 0.13
R5322:Trrap UTSW 5 144,781,034 (GRCm39) missense probably damaging 1.00
R5457:Trrap UTSW 5 144,786,787 (GRCm39) missense probably damaging 1.00
R5590:Trrap UTSW 5 144,719,075 (GRCm39) missense probably benign 0.05
R5799:Trrap UTSW 5 144,767,755 (GRCm39) missense probably benign
R5885:Trrap UTSW 5 144,731,603 (GRCm39) missense probably damaging 1.00
R5905:Trrap UTSW 5 144,786,730 (GRCm39) missense possibly damaging 0.95
R5908:Trrap UTSW 5 144,723,518 (GRCm39) missense probably damaging 0.96
R5956:Trrap UTSW 5 144,744,201 (GRCm39) splice site silent
R5992:Trrap UTSW 5 144,746,994 (GRCm39) missense probably benign 0.00
R6017:Trrap UTSW 5 144,781,051 (GRCm39) missense probably damaging 1.00
R6029:Trrap UTSW 5 144,762,724 (GRCm39) missense possibly damaging 0.75
R6029:Trrap UTSW 5 144,754,489 (GRCm39) missense possibly damaging 0.94
R6117:Trrap UTSW 5 144,739,771 (GRCm39) missense possibly damaging 0.78
R6166:Trrap UTSW 5 144,718,791 (GRCm39) missense possibly damaging 0.66
R6234:Trrap UTSW 5 144,776,523 (GRCm39) splice site probably null
R6288:Trrap UTSW 5 144,748,802 (GRCm39) missense probably damaging 1.00
R6290:Trrap UTSW 5 144,741,828 (GRCm39) missense probably damaging 1.00
R6316:Trrap UTSW 5 144,750,336 (GRCm39) missense probably benign 0.02
R6398:Trrap UTSW 5 144,727,680 (GRCm39) missense possibly damaging 0.83
R6413:Trrap UTSW 5 144,720,856 (GRCm39) missense possibly damaging 0.83
R6499:Trrap UTSW 5 144,793,812 (GRCm39) missense probably damaging 1.00
R6529:Trrap UTSW 5 144,771,014 (GRCm39) missense probably benign 0.06
R6574:Trrap UTSW 5 144,752,360 (GRCm39) critical splice donor site probably null
R6631:Trrap UTSW 5 144,708,460 (GRCm39) missense possibly damaging 0.94
R6727:Trrap UTSW 5 144,793,760 (GRCm39) missense probably damaging 1.00
R6776:Trrap UTSW 5 144,788,066 (GRCm39) nonsense probably null
R6914:Trrap UTSW 5 144,720,853 (GRCm39) missense possibly damaging 0.83
R6942:Trrap UTSW 5 144,720,853 (GRCm39) missense possibly damaging 0.83
R6945:Trrap UTSW 5 144,727,665 (GRCm39) missense possibly damaging 0.66
R7023:Trrap UTSW 5 144,728,964 (GRCm39) missense possibly damaging 0.64
R7107:Trrap UTSW 5 144,733,945 (GRCm39) missense probably benign 0.05
R7139:Trrap UTSW 5 144,739,988 (GRCm39) missense possibly damaging 0.65
R7148:Trrap UTSW 5 144,758,613 (GRCm39) missense possibly damaging 0.77
R7167:Trrap UTSW 5 144,776,424 (GRCm39) missense probably benign 0.39
R7171:Trrap UTSW 5 144,730,859 (GRCm39) missense probably damaging 1.00
R7205:Trrap UTSW 5 144,779,517 (GRCm39) missense possibly damaging 0.94
R7215:Trrap UTSW 5 144,733,945 (GRCm39) missense probably benign 0.05
R7255:Trrap UTSW 5 144,795,764 (GRCm39) missense probably damaging 1.00
R7261:Trrap UTSW 5 144,782,287 (GRCm39) missense possibly damaging 0.67
R7264:Trrap UTSW 5 144,751,333 (GRCm39) missense probably benign 0.05
R7372:Trrap UTSW 5 144,726,208 (GRCm39) missense probably benign
R7447:Trrap UTSW 5 144,776,284 (GRCm39) missense probably damaging 0.97
R7449:Trrap UTSW 5 144,788,019 (GRCm39) missense probably damaging 1.00
R7655:Trrap UTSW 5 144,779,422 (GRCm39) missense probably damaging 1.00
R7656:Trrap UTSW 5 144,779,422 (GRCm39) missense probably damaging 1.00
R7662:Trrap UTSW 5 144,769,321 (GRCm39) missense probably benign 0.00
R7716:Trrap UTSW 5 144,713,956 (GRCm39) missense possibly damaging 0.73
R8143:Trrap UTSW 5 144,772,707 (GRCm39) splice site probably null
R8183:Trrap UTSW 5 144,765,343 (GRCm39) missense probably benign 0.01
R8265:Trrap UTSW 5 144,722,344 (GRCm39) missense possibly damaging 0.53
R8273:Trrap UTSW 5 144,727,975 (GRCm39) missense probably damaging 1.00
R8556:Trrap UTSW 5 144,762,747 (GRCm39) missense probably benign 0.44
R8674:Trrap UTSW 5 144,727,842 (GRCm39) missense probably benign 0.02
R8777:Trrap UTSW 5 144,773,949 (GRCm39) missense probably benign 0.10
R8777-TAIL:Trrap UTSW 5 144,773,949 (GRCm39) missense probably benign 0.10
R8817:Trrap UTSW 5 144,782,348 (GRCm39) missense probably damaging 1.00
R8841:Trrap UTSW 5 144,781,021 (GRCm39) missense probably damaging 1.00
R8871:Trrap UTSW 5 144,758,649 (GRCm39) missense probably benign 0.30
R8937:Trrap UTSW 5 144,757,063 (GRCm39) missense probably damaging 1.00
R8966:Trrap UTSW 5 144,740,162 (GRCm39) missense probably damaging 0.96
R9010:Trrap UTSW 5 144,783,226 (GRCm39) missense probably damaging 1.00
R9095:Trrap UTSW 5 144,733,961 (GRCm39) missense probably damaging 1.00
R9127:Trrap UTSW 5 144,767,830 (GRCm39) missense probably benign 0.16
R9132:Trrap UTSW 5 144,726,362 (GRCm39) missense probably benign 0.03
R9224:Trrap UTSW 5 144,708,049 (GRCm39) missense possibly damaging 0.70
R9338:Trrap UTSW 5 144,727,925 (GRCm39) missense probably benign
R9380:Trrap UTSW 5 144,769,981 (GRCm39) missense probably benign
R9404:Trrap UTSW 5 144,752,225 (GRCm39) missense possibly damaging 0.85
R9457:Trrap UTSW 5 144,763,478 (GRCm39) missense probably damaging 1.00
R9464:Trrap UTSW 5 144,763,517 (GRCm39) missense probably damaging 0.99
R9504:Trrap UTSW 5 144,742,904 (GRCm39) missense probably damaging 1.00
R9583:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9584:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9585:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9608:Trrap UTSW 5 144,780,128 (GRCm39) missense possibly damaging 0.60
R9728:Trrap UTSW 5 144,726,193 (GRCm39) missense probably benign 0.22
R9782:Trrap UTSW 5 144,758,716 (GRCm39) missense probably damaging 0.99
X0060:Trrap UTSW 5 144,780,171 (GRCm39) missense probably damaging 0.96
Z1088:Trrap UTSW 5 144,771,007 (GRCm39) missense probably benign 0.00
Z1177:Trrap UTSW 5 144,756,518 (GRCm39) missense probably damaging 1.00
Z1177:Trrap UTSW 5 144,747,154 (GRCm39) missense
Z1177:Trrap UTSW 5 144,793,761 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTTCATTCATGCACAGC -3'
(R):5'- TTGTTTCTCAGGGTCCAGGAC -3'

Sequencing Primer
(F):5'- ATTCATGCACAGCTCTGTTCTG -3'
(R):5'- GGGGCCCAAGGAAAATATTA -3'
Posted On 2014-06-30