Mutagenetix > Incidental Mutations

Incidental Mutation 'R1903:Anpep'

209936

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

039923-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1903 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79838256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 518 (E518K)

Ref Sequence

ENSEMBL: ENSMUSP00000103015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably benign
Transcript: ENSMUST00000049004
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107392
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149164

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	C	9: 57,258,352	S246R	possibly damaging	Het
Abca13	C	T	11: 9,466,411	R4058C	probably benign	Het
Acacb	A	T	5: 114,165,734	R73*	probably null	Het
Adam22	C	T	5: 8,134,525	C489Y	probably damaging	Het
Agap3	A	T	5: 24,493,013	K460I	probably damaging	Het
Ak4	T	C	4: 101,463,636	I214T	possibly damaging	Het
Arrb2	T	A	11: 70,437,982	H221Q	probably damaging	Het
Atl1	T	G	12: 69,959,275	F452V	probably damaging	Het
Atp8b5	A	G	4: 43,357,063	T604A	probably damaging	Het
BC005561	T	A	5: 104,518,330	S239R	probably benign	Het
Bglap3	T	C	3: 88,368,761	I95V	probably benign	Het
Ccdc88a	G	T	11: 29,461,788	M532I	probably benign	Het
Ccnl1	A	G	3: 65,946,911	S430P	possibly damaging	Het
Cdk5rap2	A	T	4: 70,403,554		probably null	Het
Cep126	A	T	9: 8,120,747	Y92N	possibly damaging	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnga1	T	G	5: 72,616,725	D90A	possibly damaging	Het
Cnot1	T	C	8: 95,743,121	I1369V	possibly damaging	Het
Coq3	T	C	4: 21,910,466	S314P	probably damaging	Het
Crhr1	A	G	11: 104,169,849	R151G	probably damaging	Het
Crybg2	A	G	4: 134,078,856	I930V	probably damaging	Het
Ctcf	T	A	8: 105,675,988		probably null	Het
Dct	T	C	14: 118,034,278	N380S	probably benign	Het
Decr2	A	T	17: 26,087,413	L83Q	probably damaging	Het
Depdc5	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	5: 32,910,407		probably benign	Het
Dgkb	T	C	12: 38,166,777		probably null	Het
Dnah1	T	C	14: 31,319,759	D85G	probably damaging	Het
Dnah7a	T	C	1: 53,535,478	D1709G	probably damaging	Het
Dnajc13	A	C	9: 104,228,937	L346R	probably damaging	Het
Dsc1	A	T	18: 20,095,988	V415D	probably damaging	Het
Duox2	T	A	2: 122,295,351	I296F	probably damaging	Het
Ece2	T	A	16: 20,645,172	L890H	probably damaging	Het
Ecsit	A	G	9: 22,076,519	S75P	possibly damaging	Het
Enpp3	A	G	10: 24,778,789	C664R	probably damaging	Het
Evpl	G	T	11: 116,227,028	D778E	probably damaging	Het
Eya3	T	A	4: 132,721,352		probably null	Het
Fam217b	A	T	2: 178,420,581	I113F	probably benign	Het
Galnt6	G	A	15: 100,716,118	P101S	possibly damaging	Het
Gm11487	T	A	4: 73,403,438	Y120F	probably damaging	Het
Gm281	C	T	14: 13,829,657	S695N	possibly damaging	Het
Gm379	G	A	X: 108,664,264	Q210*	probably null	Het
Grk4	A	T	5: 34,676,187		probably null	Het
Gtf3c4	A	G	2: 28,839,956	V91A	probably benign	Het
Hcfc2	G	T	10: 82,702,558	G143V	probably damaging	Het
Heatr4	A	C	12: 83,958,447	H710Q	probably damaging	Het
Htr3a	A	T	9: 48,906,381	D97E	probably damaging	Het
Htr4	T	G	18: 62,428,122	F151L	probably benign	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Invs	T	A	4: 48,402,824		probably null	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Irs1	T	C	1: 82,289,461	S345G	probably damaging	Het
Kdm4a	A	G	4: 118,160,399	V490A	probably benign	Het
Kif26a	C	T	12: 112,175,540	R743C	probably damaging	Het
Kif28	A	G	1: 179,702,523	V691A	possibly damaging	Het
Klhl5	T	A	5: 65,166,987	L696Q	probably benign	Het
Krtap5-1	T	C	7: 142,296,347		probably benign	Het
Lama2	A	C	10: 27,188,399	D1195E	probably damaging	Het
Lamb1	T	G	12: 31,329,210	L1722R	probably damaging	Het
Lrp11	T	A	10: 7,623,780	L245Q	probably damaging	Het
Ltbp2	T	C	12: 84,830,105	E422G	probably benign	Het
Man2b1	T	A	8: 85,086,822	D214E	probably damaging	Het
Mlxipl	A	T	5: 135,133,568	D628V	possibly damaging	Het
Myo18b	G	A	5: 112,692,758	R2390C	probably damaging	Het
Mypn	T	A	10: 63,123,397	R1048S	probably benign	Het
Napepld	A	G	5: 21,665,272	S383P	probably damaging	Het
Napsa	A	G	7: 44,581,736	T130A	probably damaging	Het
Nbr1	T	C	11: 101,575,152	I716T	probably damaging	Het
Nexn	A	T	3: 152,248,181	M212K	probably damaging	Het
Nlrp9b	T	A	7: 20,023,257	S140T	probably benign	Het
Nxpe2	T	C	9: 48,319,606	T488A	probably benign	Het
Olfr1051	C	T	2: 86,275,846	V214I	probably benign	Het
Olfr1420	A	T	19: 11,896,549	Y176F	probably benign	Het
Olfr1512	T	G	14: 52,372,717	Q112P	possibly damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr834	A	T	9: 18,988,896	K303*	probably null	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Pan2	T	G	10: 128,308,368	L162R	probably damaging	Het
Parp1	G	T	1: 180,588,670	V545F	probably damaging	Het
Pcdh18	A	G	3: 49,755,447	V473A	probably benign	Het
Plb1	A	T	5: 32,291,238	N350I	probably damaging	Het
Polr1a	A	G	6: 71,967,914	K1318R	probably benign	Het
Ppp1r18	C	T	17: 35,873,846	P130S	probably damaging	Het
Prss48	C	T	3: 85,998,307	W86*	probably null	Het
Rab3c	A	T	13: 110,084,210	I137N	probably damaging	Het
Rab3gap2	G	C	1: 185,221,902	R57P	probably benign	Het
Rad54l2	A	C	9: 106,693,717		probably null	Het
Ralgapb	C	A	2: 158,495,563	N1147K	probably benign	Het
Rfx7	C	T	9: 72,616,811	R428C	probably damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Samd4	T	C	14: 47,074,128	F81S	probably damaging	Het
Shprh	T	A	10: 11,183,797	Y1097*	probably null	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Slc24a4	T	A	12: 102,131,617	D79E	probably benign	Het
Slc7a13	A	T	4: 19,839,254	I286F	probably benign	Het
Smarca1	G	A	X: 47,849,963	Q723*	probably null	Het
Spata31d1b	T	C	13: 59,718,068	L1010P	probably damaging	Het
Sult2a1	T	C	7: 13,835,975	S111G	possibly damaging	Het
Tecpr2	C	T	12: 110,947,912	T1219M	probably damaging	Het
Tesk1	T	C	4: 43,446,998	M462T	probably benign	Het
Tmem171	C	A	13: 98,686,416	G292*	probably null	Het
Tmtc2	G	T	10: 105,190,108	T833N	probably benign	Het
Tnc	G	T	4: 64,000,062	T1204K	probably benign	Het
Tnfaip3	T	C	10: 19,008,189	K148E	probably benign	Het
Tnrc18	G	A	5: 142,815,140	S21F	probably damaging	Het
Tns4	T	C	11: 99,075,575	T425A	probably damaging	Het
Tox	T	A	4: 6,688,948	Y472F	probably damaging	Het
Trak2	A	T	1: 58,918,855		probably null	Het
Trim33	T	A	3: 103,337,444	Y716N	probably damaging	Het
Trrap	T	G	5: 144,816,053	I1813R	probably damaging	Het
Ttc29	A	G	8: 78,251,732	E137G	probably benign	Het
Ube2j2	A	G	4: 155,949,026	K19R	probably benign	Het
Ubxn2b	T	C	4: 6,208,889	I206T	possibly damaging	Het
Usp40	A	G	1: 87,982,056	F559L	probably benign	Het
Utp4	T	A	8: 106,912,350		probably null	Het
Vac14	A	G	8: 110,682,534	N524S	probably benign	Het
Vps13c	T	C	9: 67,894,052	S605P	probably damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zdhhc19	C	T	16: 32,498,413	R28*	probably null	Het
Zfp106	T	C	2: 120,526,848	I1189V	probably benign	Het
Zfp189	C	T	4: 49,529,511	Q205*	probably null	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ATGAGCAGAGGTTTTACCCAC -3'
(R):5'- GCTGTCCAGTTTCCTGACAG -3'

Sequencing Primer
(F):5'- AGAGGTTTTACCCACCCTCTTTAAGG -3'
(R):5'- AGGACCTGTTTAAGAAGGGCCTTTC -3'

Posted On

2014-06-30