Incidental Mutation 'R1903:Man2b1'
ID209940
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 039923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1903 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85086822 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 214 (D214E)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000079764] [ENSMUST00000140621] [ENSMUST00000209264] [ENSMUST00000209361]
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: D214E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: D214E

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148592
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,258,352 S246R possibly damaging Het
Abca13 C T 11: 9,466,411 R4058C probably benign Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adam22 C T 5: 8,134,525 C489Y probably damaging Het
Agap3 A T 5: 24,493,013 K460I probably damaging Het
Ak4 T C 4: 101,463,636 I214T possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arrb2 T A 11: 70,437,982 H221Q probably damaging Het
Atl1 T G 12: 69,959,275 F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 T604A probably damaging Het
BC005561 T A 5: 104,518,330 S239R probably benign Het
Bglap3 T C 3: 88,368,761 I95V probably benign Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Ccnl1 A G 3: 65,946,911 S430P possibly damaging Het
Cdk5rap2 A T 4: 70,403,554 probably null Het
Cep126 A T 9: 8,120,747 Y92N possibly damaging Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnga1 T G 5: 72,616,725 D90A possibly damaging Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Coq3 T C 4: 21,910,466 S314P probably damaging Het
Crhr1 A G 11: 104,169,849 R151G probably damaging Het
Crybg2 A G 4: 134,078,856 I930V probably damaging Het
Ctcf T A 8: 105,675,988 probably null Het
Dct T C 14: 118,034,278 N380S probably benign Het
Decr2 A T 17: 26,087,413 L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dgkb T C 12: 38,166,777 probably null Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnajc13 A C 9: 104,228,937 L346R probably damaging Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
Duox2 T A 2: 122,295,351 I296F probably damaging Het
Ece2 T A 16: 20,645,172 L890H probably damaging Het
Ecsit A G 9: 22,076,519 S75P possibly damaging Het
Enpp3 A G 10: 24,778,789 C664R probably damaging Het
Evpl G T 11: 116,227,028 D778E probably damaging Het
Eya3 T A 4: 132,721,352 probably null Het
Fam217b A T 2: 178,420,581 I113F probably benign Het
Galnt6 G A 15: 100,716,118 P101S possibly damaging Het
Gm11487 T A 4: 73,403,438 Y120F probably damaging Het
Gm281 C T 14: 13,829,657 S695N possibly damaging Het
Gm379 G A X: 108,664,264 Q210* probably null Het
Grk4 A T 5: 34,676,187 probably null Het
Gtf3c4 A G 2: 28,839,956 V91A probably benign Het
Hcfc2 G T 10: 82,702,558 G143V probably damaging Het
Heatr4 A C 12: 83,958,447 H710Q probably damaging Het
Htr3a A T 9: 48,906,381 D97E probably damaging Het
Htr4 T G 18: 62,428,122 F151L probably benign Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Invs T A 4: 48,402,824 probably null Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irs1 T C 1: 82,289,461 S345G probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif26a C T 12: 112,175,540 R743C probably damaging Het
Kif28 A G 1: 179,702,523 V691A possibly damaging Het
Klhl5 T A 5: 65,166,987 L696Q probably benign Het
Krtap5-1 T C 7: 142,296,347 probably benign Het
Lama2 A C 10: 27,188,399 D1195E probably damaging Het
Lamb1 T G 12: 31,329,210 L1722R probably damaging Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Ltbp2 T C 12: 84,830,105 E422G probably benign Het
Mlxipl A T 5: 135,133,568 D628V possibly damaging Het
Myo18b G A 5: 112,692,758 R2390C probably damaging Het
Mypn T A 10: 63,123,397 R1048S probably benign Het
Napepld A G 5: 21,665,272 S383P probably damaging Het
Napsa A G 7: 44,581,736 T130A probably damaging Het
Nbr1 T C 11: 101,575,152 I716T probably damaging Het
Nexn A T 3: 152,248,181 M212K probably damaging Het
Nlrp9b T A 7: 20,023,257 S140T probably benign Het
Nxpe2 T C 9: 48,319,606 T488A probably benign Het
Olfr1051 C T 2: 86,275,846 V214I probably benign Het
Olfr1420 A T 19: 11,896,549 Y176F probably benign Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr834 A T 9: 18,988,896 K303* probably null Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pan2 T G 10: 128,308,368 L162R probably damaging Het
Parp1 G T 1: 180,588,670 V545F probably damaging Het
Pcdh18 A G 3: 49,755,447 V473A probably benign Het
Plb1 A T 5: 32,291,238 N350I probably damaging Het
Polr1a A G 6: 71,967,914 K1318R probably benign Het
Ppp1r18 C T 17: 35,873,846 P130S probably damaging Het
Prss48 C T 3: 85,998,307 W86* probably null Het
Rab3c A T 13: 110,084,210 I137N probably damaging Het
Rab3gap2 G C 1: 185,221,902 R57P probably benign Het
Rad54l2 A C 9: 106,693,717 probably null Het
Ralgapb C A 2: 158,495,563 N1147K probably benign Het
Rfx7 C T 9: 72,616,811 R428C probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Shprh T A 10: 11,183,797 Y1097* probably null Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc24a4 T A 12: 102,131,617 D79E probably benign Het
Slc7a13 A T 4: 19,839,254 I286F probably benign Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Spata31d1b T C 13: 59,718,068 L1010P probably damaging Het
Sult2a1 T C 7: 13,835,975 S111G possibly damaging Het
Tecpr2 C T 12: 110,947,912 T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 M462T probably benign Het
Tmem171 C A 13: 98,686,416 G292* probably null Het
Tmtc2 G T 10: 105,190,108 T833N probably benign Het
Tnc G T 4: 64,000,062 T1204K probably benign Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Tnrc18 G A 5: 142,815,140 S21F probably damaging Het
Tns4 T C 11: 99,075,575 T425A probably damaging Het
Tox T A 4: 6,688,948 Y472F probably damaging Het
Trak2 A T 1: 58,918,855 probably null Het
Trim33 T A 3: 103,337,444 Y716N probably damaging Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Ube2j2 A G 4: 155,949,026 K19R probably benign Het
Ubxn2b T C 4: 6,208,889 I206T possibly damaging Het
Usp40 A G 1: 87,982,056 F559L probably benign Het
Utp4 T A 8: 106,912,350 probably null Het
Vac14 A G 8: 110,682,534 N524S probably benign Het
Vps13c T C 9: 67,894,052 S605P probably damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zdhhc19 C T 16: 32,498,413 R28* probably null Het
Zfp106 T C 2: 120,526,848 I1189V probably benign Het
Zfp189 C T 4: 49,529,511 Q205* probably null Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 unclassified probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACACAGGACTGTAGGATC -3'
(R):5'- ACGACACCAGGACTCTTCTG -3'

Sequencing Primer
(F):5'- ATCCCCTGGCACTGAGGTAATG -3'
(R):5'- AGGACTCTTCTGGGCTCGAG -3'
Posted On2014-06-30