Mutagenetix > Incidental Mutation

Incidental Mutation 'R1903:Cnot1'

209941

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

039923-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1903 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95743121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1369 (I1369V)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: I1369V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1369V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083155

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I1374V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1374V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: I1367V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000211973

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: I1374V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	C	9: 57,258,352	S246R	possibly damaging	Het
Abca13	C	T	11: 9,466,411	R4058C	probably benign	Het
Acacb	A	T	5: 114,165,734	R73*	probably null	Het
Adam22	C	T	5: 8,134,525	C489Y	probably damaging	Het
Agap3	A	T	5: 24,493,013	K460I	probably damaging	Het
Ak4	T	C	4: 101,463,636	I214T	possibly damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arrb2	T	A	11: 70,437,982	H221Q	probably damaging	Het
Atl1	T	G	12: 69,959,275	F452V	probably damaging	Het
Atp8b5	A	G	4: 43,357,063	T604A	probably damaging	Het
BC005561	T	A	5: 104,518,330	S239R	probably benign	Het
Bglap3	T	C	3: 88,368,761	I95V	probably benign	Het
Ccdc88a	G	T	11: 29,461,788	M532I	probably benign	Het
Ccnl1	A	G	3: 65,946,911	S430P	possibly damaging	Het
Cdk5rap2	A	T	4: 70,403,554		probably null	Het
Cep126	A	T	9: 8,120,747	Y92N	possibly damaging	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnga1	T	G	5: 72,616,725	D90A	possibly damaging	Het
Coq3	T	C	4: 21,910,466	S314P	probably damaging	Het
Crhr1	A	G	11: 104,169,849	R151G	probably damaging	Het
Crybg2	A	G	4: 134,078,856	I930V	probably damaging	Het
Ctcf	T	A	8: 105,675,988		probably null	Het
Dct	T	C	14: 118,034,278	N380S	probably benign	Het
Decr2	A	T	17: 26,087,413	L83Q	probably damaging	Het
Depdc5	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	5: 32,910,407		probably benign	Het
Dgkb	T	C	12: 38,166,777		probably null	Het
Dnah1	T	C	14: 31,319,759	D85G	probably damaging	Het
Dnah7a	T	C	1: 53,535,478	D1709G	probably damaging	Het
Dnajc13	A	C	9: 104,228,937	L346R	probably damaging	Het
Dsc1	A	T	18: 20,095,988	V415D	probably damaging	Het
Duox2	T	A	2: 122,295,351	I296F	probably damaging	Het
Ece2	T	A	16: 20,645,172	L890H	probably damaging	Het
Ecsit	A	G	9: 22,076,519	S75P	possibly damaging	Het
Enpp3	A	G	10: 24,778,789	C664R	probably damaging	Het
Evpl	G	T	11: 116,227,028	D778E	probably damaging	Het
Eya3	T	A	4: 132,721,352		probably null	Het
Fam217b	A	T	2: 178,420,581	I113F	probably benign	Het
Galnt6	G	A	15: 100,716,118	P101S	possibly damaging	Het
Gm11487	T	A	4: 73,403,438	Y120F	probably damaging	Het
Gm281	C	T	14: 13,829,657	S695N	possibly damaging	Het
Gm379	G	A	X: 108,664,264	Q210*	probably null	Het
Grk4	A	T	5: 34,676,187		probably null	Het
Gtf3c4	A	G	2: 28,839,956	V91A	probably benign	Het
Hcfc2	G	T	10: 82,702,558	G143V	probably damaging	Het
Heatr4	A	C	12: 83,958,447	H710Q	probably damaging	Het
Htr3a	A	T	9: 48,906,381	D97E	probably damaging	Het
Htr4	T	G	18: 62,428,122	F151L	probably benign	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Invs	T	A	4: 48,402,824		probably null	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Irs1	T	C	1: 82,289,461	S345G	probably damaging	Het
Kdm4a	A	G	4: 118,160,399	V490A	probably benign	Het
Kif26a	C	T	12: 112,175,540	R743C	probably damaging	Het
Kif28	A	G	1: 179,702,523	V691A	possibly damaging	Het
Klhl5	T	A	5: 65,166,987	L696Q	probably benign	Het
Krtap5-1	T	C	7: 142,296,347		probably benign	Het
Lama2	A	C	10: 27,188,399	D1195E	probably damaging	Het
Lamb1	T	G	12: 31,329,210	L1722R	probably damaging	Het
Lrp11	T	A	10: 7,623,780	L245Q	probably damaging	Het
Ltbp2	T	C	12: 84,830,105	E422G	probably benign	Het
Man2b1	T	A	8: 85,086,822	D214E	probably damaging	Het
Mlxipl	A	T	5: 135,133,568	D628V	possibly damaging	Het
Myo18b	G	A	5: 112,692,758	R2390C	probably damaging	Het
Mypn	T	A	10: 63,123,397	R1048S	probably benign	Het
Napepld	A	G	5: 21,665,272	S383P	probably damaging	Het
Napsa	A	G	7: 44,581,736	T130A	probably damaging	Het
Nbr1	T	C	11: 101,575,152	I716T	probably damaging	Het
Nexn	A	T	3: 152,248,181	M212K	probably damaging	Het
Nlrp9b	T	A	7: 20,023,257	S140T	probably benign	Het
Nxpe2	T	C	9: 48,319,606	T488A	probably benign	Het
Olfr1051	C	T	2: 86,275,846	V214I	probably benign	Het
Olfr1420	A	T	19: 11,896,549	Y176F	probably benign	Het
Olfr1512	T	G	14: 52,372,717	Q112P	possibly damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr834	A	T	9: 18,988,896	K303*	probably null	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Pan2	T	G	10: 128,308,368	L162R	probably damaging	Het
Parp1	G	T	1: 180,588,670	V545F	probably damaging	Het
Pcdh18	A	G	3: 49,755,447	V473A	probably benign	Het
Plb1	A	T	5: 32,291,238	N350I	probably damaging	Het
Polr1a	A	G	6: 71,967,914	K1318R	probably benign	Het
Ppp1r18	C	T	17: 35,873,846	P130S	probably damaging	Het
Prss48	C	T	3: 85,998,307	W86*	probably null	Het
Rab3c	A	T	13: 110,084,210	I137N	probably damaging	Het
Rab3gap2	G	C	1: 185,221,902	R57P	probably benign	Het
Rad54l2	A	C	9: 106,693,717		probably null	Het
Ralgapb	C	A	2: 158,495,563	N1147K	probably benign	Het
Rfx7	C	T	9: 72,616,811	R428C	probably damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Samd4	T	C	14: 47,074,128	F81S	probably damaging	Het
Shprh	T	A	10: 11,183,797	Y1097*	probably null	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Slc24a4	T	A	12: 102,131,617	D79E	probably benign	Het
Slc7a13	A	T	4: 19,839,254	I286F	probably benign	Het
Smarca1	G	A	X: 47,849,963	Q723*	probably null	Het
Spata31d1b	T	C	13: 59,718,068	L1010P	probably damaging	Het
Sult2a1	T	C	7: 13,835,975	S111G	possibly damaging	Het
Tecpr2	C	T	12: 110,947,912	T1219M	probably damaging	Het
Tesk1	T	C	4: 43,446,998	M462T	probably benign	Het
Tmem171	C	A	13: 98,686,416	G292*	probably null	Het
Tmtc2	G	T	10: 105,190,108	T833N	probably benign	Het
Tnc	G	T	4: 64,000,062	T1204K	probably benign	Het
Tnfaip3	T	C	10: 19,008,189	K148E	probably benign	Het
Tnrc18	G	A	5: 142,815,140	S21F	probably damaging	Het
Tns4	T	C	11: 99,075,575	T425A	probably damaging	Het
Tox	T	A	4: 6,688,948	Y472F	probably damaging	Het
Trak2	A	T	1: 58,918,855		probably null	Het
Trim33	T	A	3: 103,337,444	Y716N	probably damaging	Het
Trrap	T	G	5: 144,816,053	I1813R	probably damaging	Het
Ttc29	A	G	8: 78,251,732	E137G	probably benign	Het
Ube2j2	A	G	4: 155,949,026	K19R	probably benign	Het
Ubxn2b	T	C	4: 6,208,889	I206T	possibly damaging	Het
Usp40	A	G	1: 87,982,056	F559L	probably benign	Het
Utp4	T	A	8: 106,912,350		probably null	Het
Vac14	A	G	8: 110,682,534	N524S	probably benign	Het
Vps13c	T	C	9: 67,894,052	S605P	probably damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zdhhc19	C	T	16: 32,498,413	R28*	probably null	Het
Zfp106	T	C	2: 120,526,848	I1189V	probably benign	Het
Zfp189	C	T	4: 49,529,511	Q205*	probably null	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GTTCACTGCCACAAACTAGAAGTC -3'
(R):5'- TAGCTGCCCCTACTCAAGAG -3'

Sequencing Primer
(F):5'- GGATCAGGATTTGATTCCCAGAACC -3'
(R):5'- ATTATCCAGCTGATTTCTTTGTTCAG -3'

Posted On

2014-06-30