Incidental Mutation 'R0119:Caskin2'
ID20995
Institutional Source Beutler Lab
Gene Symbol Caskin2
Ensembl Gene ENSMUSG00000034471
Gene NameCASK-interacting protein 2
Synonyms1600028L06Rik
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R0119 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115799183-115813639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 115802427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000132780] [ENSMUST00000156812]
Predicted Effect probably benign
Transcript: ENSMUST00000041684
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093912
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103033
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000132780
SMART Domains Protein: ENSMUSP00000119158
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 27 56 3.01e-4 SMART
ANK 60 89 3.41e-3 SMART
ANK 93 122 1.4e-4 SMART
ANK 126 155 3.26e0 SMART
ANK 167 196 3.33e-6 SMART
ANK 199 228 4.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156812
SMART Domains Protein: ENSMUSP00000114310
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Caskin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Caskin2 APN 11 115803599 missense probably benign 0.00
IGL01936:Caskin2 APN 11 115804717 missense probably damaging 0.99
IGL02322:Caskin2 APN 11 115804477 missense probably damaging 0.99
R0127:Caskin2 UTSW 11 115800994 missense probably damaging 1.00
R0565:Caskin2 UTSW 11 115801016 missense probably damaging 1.00
R0741:Caskin2 UTSW 11 115804800 missense probably damaging 1.00
R1332:Caskin2 UTSW 11 115803345 unclassified probably benign
R1474:Caskin2 UTSW 11 115803696 missense probably benign 0.05
R1720:Caskin2 UTSW 11 115802782 missense probably damaging 1.00
R1968:Caskin2 UTSW 11 115803614 missense probably benign 0.00
R2054:Caskin2 UTSW 11 115806301 unclassified probably benign
R2061:Caskin2 UTSW 11 115803630 missense probably benign
R2893:Caskin2 UTSW 11 115801277 missense probably benign 0.00
R3036:Caskin2 UTSW 11 115806356 missense probably damaging 1.00
R3123:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R3124:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R4822:Caskin2 UTSW 11 115807299 missense probably damaging 1.00
R5095:Caskin2 UTSW 11 115800738 missense probably benign
R5654:Caskin2 UTSW 11 115800079 critical splice acceptor site probably null
R5743:Caskin2 UTSW 11 115802289 missense possibly damaging 0.66
R5801:Caskin2 UTSW 11 115803473 missense probably damaging 1.00
R5808:Caskin2 UTSW 11 115801763 missense probably damaging 1.00
R6259:Caskin2 UTSW 11 115800453 missense probably damaging 1.00
R6618:Caskin2 UTSW 11 115800029 missense possibly damaging 0.89
R7142:Caskin2 UTSW 11 115806736 missense probably benign 0.29
R7192:Caskin2 UTSW 11 115801376 missense probably damaging 1.00
R7247:Caskin2 UTSW 11 115801896 missense probably benign
R7290:Caskin2 UTSW 11 115804789 missense possibly damaging 0.63
R7451:Caskin2 UTSW 11 115812155 start gained probably benign
X0063:Caskin2 UTSW 11 115806412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCTGCCAGCCGTTTCACACC -3'
(R):5'- CGGAGATTGCCCAGCTTAGCATTG -3'

Sequencing Primer
(F):5'- GCCGTTTCACACCTAGCATTAG -3'
(R):5'- TGCCCAATTATATCCCGGTG -3'
Posted On2013-04-11