Incidental Mutation 'R1908:Gm14412'
ID210032
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Namepredicted gene 14412
Synonyms
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R1908 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location177314520-177324307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 177315837 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 88 (S88R)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
Predicted Effect probably benign
Transcript: ENSMUST00000108959
AA Change: S88R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: S88R

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Grhl1 T A 12: 24,608,556 L400Q probably damaging Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hephl1 A C 9: 15,074,124 Y745* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slc7a2 T C 8: 40,916,497 L663S probably benign Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smc2 T C 4: 52,450,863 I227T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177315686 missense probably benign
R0124:Gm14412 UTSW 2 177315912 splice site probably benign
R0507:Gm14412 UTSW 2 177314532 missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177315790 missense probably benign 0.00
R1908:Gm14412 UTSW 2 177315476 missense probably damaging 1.00
R2026:Gm14412 UTSW 2 177317105 missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177317436 missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177315200 missense unknown
R3946:Gm14412 UTSW 2 177314685 nonsense probably null
R4430:Gm14412 UTSW 2 177315832 missense probably benign 0.09
R4537:Gm14412 UTSW 2 177314559 missense probably benign 0.06
R4595:Gm14412 UTSW 2 177315212 missense unknown
R4928:Gm14412 UTSW 2 177314580 missense probably benign 0.01
R5100:Gm14412 UTSW 2 177315115 missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177314612 missense probably damaging 1.00
R5668:Gm14412 UTSW 2 177315609 nonsense probably null
R6173:Gm14412 UTSW 2 177314537 missense probably damaging 1.00
R6558:Gm14412 UTSW 2 177314554 missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177317340 missense probably benign 0.10
R7094:Gm14412 UTSW 2 177317345 missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177315615 missense probably benign 0.44
R7254:Gm14412 UTSW 2 177317396 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTCATAGGGTTTCTCTCCTGTATG -3'
(R):5'- TGCAATCATTGTGCAAATACTGTG -3'

Sequencing Primer
(F):5'- ATGTTTTTGGAGGTCACCACTTC -3'
(R):5'- GGTGAGCCAGATAATCAGTACTGTTC -3'
Posted On2014-06-30