Mutagenetix > Incidental Mutations

Incidental Mutation 'R1908:Cic'

210048

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

039927-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R1908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25286840 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1229 (T1229K)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005578
AA Change: T322K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: T322K

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163320
AA Change: T322K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: T322K

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165239
AA Change: T322K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: T322K

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: T1229K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: T1229K

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,226,575	D292E	probably damaging	Het
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
Abca8b	C	A	11: 109,957,098	L852F	possibly damaging	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Alg11	T	G	8: 22,065,568	C240G	probably damaging	Het
Aox1	A	G	1: 58,102,624	I1190V	probably damaging	Het
Apc2	T	G	10: 80,314,844	S1911A	probably benign	Het
Arfgef3	T	C	10: 18,652,763	D292G	possibly damaging	Het
Arhgef4	C	A	1: 34,724,259	S865R	probably benign	Het
Ass1	T	A	2: 31,493,148	Y190*	probably null	Het
B4galnt3	A	T	6: 120,210,090		probably null	Het
Btnl10	C	A	11: 58,920,541	P230Q	possibly damaging	Het
C3	A	G	17: 57,209,489	Y1348H	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Clip4	T	C	17: 71,837,749	S524P	probably damaging	Het
Col6a3	A	C	1: 90,811,699	I269R	probably damaging	Het
Dbh	C	T	2: 27,181,494	T533I	possibly damaging	Het
Dcaf17	A	T	2: 71,060,369	R83*	probably null	Het
Dnah1	A	G	14: 31,262,558	L3923P	probably damaging	Het
Dnah7a	A	T	1: 53,631,562	D510E	probably benign	Het
Dock6	A	G	9: 21,841,629	F296S	probably damaging	Het
Eif4enif1	T	C	11: 3,227,455	S341P	probably damaging	Het
Epb41l1	G	T	2: 156,510,817	G461V	possibly damaging	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Gm10684	A	G	9: 45,110,213		probably benign	Het
Gm12185	T	C	11: 48,915,404	E320G	probably benign	Het
Gm14412	G	T	2: 177,315,476	H209N	probably damaging	Het
Gm14412	A	C	2: 177,315,837	S88R	probably benign	Het
Grhl1	T	A	12: 24,608,556	L400Q	probably damaging	Het
Havcr1	T	A	11: 46,773,684	Y216*	probably null	Het
Hephl1	A	C	9: 15,074,124	Y745*	probably null	Het
Hmcn2	T	G	2: 31,411,910		probably null	Het
Hs3st6	A	G	17: 24,758,136	K197E	possibly damaging	Het
Ifi214	C	T	1: 173,529,511	V9I	probably benign	Het
Jakmip2	T	C	18: 43,567,144	T450A	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Macf1	A	T	4: 123,457,841	H1634Q	possibly damaging	Het
Mcpt8	T	A	14: 56,083,834	I58F	probably benign	Het
Mga	T	A	2: 119,926,594	H1018Q	possibly damaging	Het
Myo10	T	A	15: 25,801,222	V1499E	probably damaging	Het
Myom2	G	T	8: 15,081,023	D320Y	probably damaging	Het
Olfr1220	G	A	2: 89,097,544	P128S	probably damaging	Het
Olfr1395	A	C	11: 49,148,274	N6H	possibly damaging	Het
Olfr458	C	T	6: 42,460,426	V198M	probably benign	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr74	A	T	2: 87,974,059	V202D	possibly damaging	Het
Olfr740	T	A	14: 50,453,838	M262K	probably damaging	Het
Pabpc4	G	T	4: 123,289,068	R166L	possibly damaging	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prdm15	G	T	16: 97,837,685	D58E	probably benign	Het
Rgl2	A	G	17: 33,932,148	T117A	probably benign	Het
Rp1	A	G	1: 4,348,720	I723T	probably damaging	Het
Serpina3g	A	G	12: 104,241,277	E233G	probably damaging	Het
Skint6	T	A	4: 112,891,990	S798C	probably benign	Het
Slc35f1	T	C	10: 53,021,904	L137P	possibly damaging	Het
Slc6a20a	T	C	9: 123,656,308	N246S	probably damaging	Het
Slc7a2	T	C	8: 40,916,497	L663S	probably benign	Het
Slco1a4	A	G	6: 141,815,447		probably null	Het
Slit2	A	G	5: 48,281,988	T41A	probably damaging	Het
Smc2	T	C	4: 52,450,863	I227T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Ssu2	A	T	6: 112,384,427	L23M	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
Syne2	A	G	12: 76,094,279		probably null	Het
Tekt1	T	C	11: 72,351,935	T249A	probably benign	Het
Tfr2	T	C	5: 137,571,692	V120A	probably benign	Het
Thsd7b	C	T	1: 129,678,109	P529L	probably damaging	Het
Tll1	C	T	8: 64,025,107	D871N	probably damaging	Het
Tlr11	A	C	14: 50,361,207	I217L	probably benign	Het
Tmem87b	T	A	2: 128,831,559	V241D	probably damaging	Het
Tshz2	T	A	2: 169,885,545	I218N	possibly damaging	Het
Vmn1r18	A	T	6: 57,390,041	I176N	possibly damaging	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vmn2r74	T	C	7: 85,952,442	T663A	probably benign	Het
Vmn2r8	T	C	5: 108,797,570	T724A	probably benign	Het
Wdr11	T	C	7: 129,605,230	V289A	possibly damaging	Het
Zfp62	T	A	11: 49,216,220	D379E	probably damaging	Het
Zfp78	C	T	7: 6,378,898	P316S	probably damaging	Het
Zfyve27	T	G	19: 42,171,548	M1R	probably null	Het
Zkscan8	G	A	13: 21,525,155	P191L	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCAGAATGTCTGCTTCCGG -3'
(R):5'- ACCTGGGTCAGTTCTTGAAG -3'

Sequencing Primer
(F):5'- CAGAATGTCTGCTTCCGGAAACG -3'
(R):5'- GAAGTGCTTGGCTGTCTACTTCC -3'

Posted On

2014-06-30