Incidental Mutation 'R1908:Hephl1'
ID210066
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Namehephaestin-like 1
SynonymsLOC244698, zyklopen, Zp
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1908 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15051841-15112108 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 15074124 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 745 (Y745*)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
Predicted Effect probably null
Transcript: ENSMUST00000159985
AA Change: Y745*
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: Y745*

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Gm14412 G T 2: 177,315,476 H209N probably damaging Het
Gm14412 A C 2: 177,315,837 S88R probably benign Het
Grhl1 T A 12: 24,608,556 L400Q probably damaging Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slc7a2 T C 8: 40,916,497 L663S probably benign Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smc2 T C 4: 52,450,863 I227T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
R7715:Hephl1 UTSW 9 15060785 missense probably benign 0.36
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGACAGAAGCGTCTC -3'
(R):5'- GAAATCTCAAGTCATGGTCACC -3'

Sequencing Primer
(F):5'- TGCGCTCATAAGGAAGTCTC -3'
(R):5'- AAATCTCAAGTCATGGTCACCTTTTC -3'
Posted On2014-06-30