Incidental Mutation 'R1908:Grhl1'
ID 210084
Institutional Source Beutler Lab
Gene Symbol Grhl1
Ensembl Gene ENSMUSG00000020656
Gene Name grainyhead like transcription factor 1
Synonyms LBP-32, p70 MGR, p61 MGR, Tcfcp2l2
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1908 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 24572283-24617391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24608556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 400 (L400Q)
Ref Sequence ENSEMBL: ENSMUSP00000020985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]
AlphaFold Q921D9
Predicted Effect probably damaging
Transcript: ENSMUST00000020985
AA Change: L400Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656
AA Change: L400Q

DomainStartEndE-ValueType
Pfam:CP2 133 362 1.8e-87 PFAM
low complexity region 406 421 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085553
AA Change: L482Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: L482Q

DomainStartEndE-ValueType
Pfam:CP2 228 442 1.9e-82 PFAM
low complexity region 488 503 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223442
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Gm14412 G T 2: 177,315,476 H209N probably damaging Het
Gm14412 A C 2: 177,315,837 S88R probably benign Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hephl1 A C 9: 15,074,124 Y745* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slc7a2 T C 8: 40,916,497 L663S probably benign Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smc2 T C 4: 52,450,863 I227T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Grhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Grhl1 APN 12 24612170 missense probably damaging 1.00
IGL01104:Grhl1 APN 12 24584454 missense probably damaging 1.00
IGL01335:Grhl1 APN 12 24608058 missense probably damaging 1.00
IGL01660:Grhl1 APN 12 24608578 splice site probably null
IGL01725:Grhl1 APN 12 24609748 splice site probably benign
IGL02869:Grhl1 APN 12 24581491 missense probably damaging 1.00
bandit UTSW 12 24578027 missense probably benign 0.31
cembalo UTSW 12 24586152 critical splice donor site probably null
gamba UTSW 12 24612245 splice site probably benign
Spinnet UTSW 12 24584946 critical splice donor site probably null
R0048:Grhl1 UTSW 12 24612151 splice site probably benign
R0373:Grhl1 UTSW 12 24581515 missense probably benign 0.00
R0432:Grhl1 UTSW 12 24582919 missense probably benign 0.29
R0442:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R1531:Grhl1 UTSW 12 24582963 critical splice donor site probably null
R1646:Grhl1 UTSW 12 24611861 missense possibly damaging 0.64
R1874:Grhl1 UTSW 12 24586156 splice site probably benign
R1892:Grhl1 UTSW 12 24584910 missense probably damaging 1.00
R2051:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R2199:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R2233:Grhl1 UTSW 12 24608511 missense probably damaging 0.98
R3803:Grhl1 UTSW 12 24584919 missense probably damaging 1.00
R3864:Grhl1 UTSW 12 24615930 makesense probably null
R4227:Grhl1 UTSW 12 24611851 missense probably benign
R4682:Grhl1 UTSW 12 24608433 missense probably benign 0.00
R4709:Grhl1 UTSW 12 24586133 missense possibly damaging 0.57
R5096:Grhl1 UTSW 12 24603050 missense probably damaging 1.00
R5149:Grhl1 UTSW 12 24612179 small deletion probably benign
R5580:Grhl1 UTSW 12 24609740 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6110:Grhl1 UTSW 12 24580747 splice site probably null
R6351:Grhl1 UTSW 12 24584858 missense probably damaging 0.98
R7018:Grhl1 UTSW 12 24575997 missense possibly damaging 0.47
R8211:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R8723:Grhl1 UTSW 12 24612245 splice site probably benign
R8898:Grhl1 UTSW 12 24584946 critical splice donor site probably null
R9575:Grhl1 UTSW 12 24586083 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTGAGTTTCTGCTGC -3'
(R):5'- AGGTGACAGATGCGGCATTG -3'

Sequencing Primer
(F):5'- AGCTCACTTTATAGACCAGGCTGG -3'
(R):5'- AGATGCGGCATTGCGCAAC -3'
Posted On 2014-06-30