Incidental Mutation 'R1908:Jakmip2'
ID 210104
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 039927-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R1908 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43700209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 450 (T450A)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: T450A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: T450A

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,847,924 (GRCm39) L852F possibly damaging Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Alg11 T G 8: 22,555,584 (GRCm39) C240G probably damaging Het
Aox1 A G 1: 58,141,783 (GRCm39) I1190V probably damaging Het
Apc2 T G 10: 80,150,678 (GRCm39) S1911A probably benign Het
Arfgef3 T C 10: 18,528,511 (GRCm39) D292G possibly damaging Het
Arhgef4 C A 1: 34,763,340 (GRCm39) S865R probably benign Het
Ass1 T A 2: 31,383,160 (GRCm39) Y190* probably null Het
B4galnt3 A T 6: 120,187,051 (GRCm39) probably null Het
Btnl10 C A 11: 58,811,367 (GRCm39) P230Q possibly damaging Het
C3 A G 17: 57,516,489 (GRCm39) Y1348H probably damaging Het
Ccdc198 G T 14: 49,464,032 (GRCm39) D292E probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cic C A 7: 24,986,265 (GRCm39) T1229K probably damaging Het
Clip4 T C 17: 72,144,744 (GRCm39) S524P probably damaging Het
Col6a3 A C 1: 90,739,421 (GRCm39) I269R probably damaging Het
Dbh C T 2: 27,071,506 (GRCm39) T533I possibly damaging Het
Dcaf17 A T 2: 70,890,713 (GRCm39) R83* probably null Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dnah1 A G 14: 30,984,515 (GRCm39) L3923P probably damaging Het
Dnah7a A T 1: 53,670,721 (GRCm39) D510E probably benign Het
Dock6 A G 9: 21,752,925 (GRCm39) F296S probably damaging Het
Eif4enif1 T C 11: 3,177,455 (GRCm39) S341P probably damaging Het
Epb41l1 G T 2: 156,352,737 (GRCm39) G461V possibly damaging Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gm10684 A G 9: 45,021,511 (GRCm39) probably benign Het
Gm12185 T C 11: 48,806,231 (GRCm39) E320G probably benign Het
Gm14412 G T 2: 177,007,269 (GRCm39) H209N probably damaging Het
Gm14412 A C 2: 177,007,630 (GRCm39) S88R probably benign Het
Grhl1 T A 12: 24,658,555 (GRCm39) L400Q probably damaging Het
Havcr1 T A 11: 46,664,511 (GRCm39) Y216* probably null Het
Hephl1 A C 9: 14,985,420 (GRCm39) Y745* probably null Het
Hmcn2 T G 2: 31,301,922 (GRCm39) probably null Het
Hs3st6 A G 17: 24,977,110 (GRCm39) K197E possibly damaging Het
Ifi214 C T 1: 173,357,077 (GRCm39) V9I probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Macf1 A T 4: 123,351,634 (GRCm39) H1634Q possibly damaging Het
Mcpt8 T A 14: 56,321,291 (GRCm39) I58F probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Myo10 T A 15: 25,801,308 (GRCm39) V1499E probably damaging Het
Myom2 G T 8: 15,131,023 (GRCm39) D320Y probably damaging Het
Or11g7 T A 14: 50,691,295 (GRCm39) M262K probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2r11 C T 6: 42,437,360 (GRCm39) V198M probably benign Het
Or2t26 A C 11: 49,039,101 (GRCm39) N6H possibly damaging Het
Or4c115 G A 2: 88,927,888 (GRCm39) P128S probably damaging Het
Or5d47 A T 2: 87,804,403 (GRCm39) V202D possibly damaging Het
Pabpc4 G T 4: 123,182,861 (GRCm39) R166L possibly damaging Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prdm15 G T 16: 97,638,885 (GRCm39) D58E probably benign Het
Rgl2 A G 17: 34,151,122 (GRCm39) T117A probably benign Het
Rp1 A G 1: 4,418,943 (GRCm39) I723T probably damaging Het
Serpina3g A G 12: 104,207,536 (GRCm39) E233G probably damaging Het
Skint6 T A 4: 112,749,187 (GRCm39) S798C probably benign Het
Slc35f1 T C 10: 52,898,000 (GRCm39) L137P possibly damaging Het
Slc6a20a T C 9: 123,485,373 (GRCm39) N246S probably damaging Het
Slc7a2 T C 8: 41,369,534 (GRCm39) L663S probably benign Het
Slco1a4 A G 6: 141,761,173 (GRCm39) probably null Het
Slit2 A G 5: 48,439,330 (GRCm39) T41A probably damaging Het
Smc2 T C 4: 52,450,863 (GRCm39) I227T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Ssu2 A T 6: 112,361,388 (GRCm39) L23M probably benign Het
Syne2 A G 12: 76,141,053 (GRCm39) probably null Het
Tekt1 T C 11: 72,242,761 (GRCm39) T249A probably benign Het
Tfr2 T C 5: 137,569,954 (GRCm39) V120A probably benign Het
Thsd7b C T 1: 129,605,846 (GRCm39) P529L probably damaging Het
Tll1 C T 8: 64,478,141 (GRCm39) D871N probably damaging Het
Tlr11 A C 14: 50,598,664 (GRCm39) I217L probably benign Het
Tmem87b T A 2: 128,673,479 (GRCm39) V241D probably damaging Het
Tshz2 T A 2: 169,727,465 (GRCm39) I218N possibly damaging Het
Vmn1r18 A T 6: 57,367,026 (GRCm39) I176N possibly damaging Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vmn2r74 T C 7: 85,601,650 (GRCm39) T663A probably benign Het
Vmn2r8 T C 5: 108,945,436 (GRCm39) T724A probably benign Het
Wdr11 T C 7: 129,206,954 (GRCm39) V289A possibly damaging Het
Zfp62 T A 11: 49,107,047 (GRCm39) D379E probably damaging Het
Zfp78 C T 7: 6,381,897 (GRCm39) P316S probably damaging Het
Zfyve27 T G 19: 42,159,987 (GRCm39) M1R probably null Het
Zkscan8 G A 13: 21,709,325 (GRCm39) P191L probably damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43,698,995 (GRCm39) missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43,710,390 (GRCm39) missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43,704,191 (GRCm39) missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43,704,973 (GRCm39) missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43,696,398 (GRCm39) missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGGTTTGAAAAGTCCCTAGGG -3'
(R):5'- TCCGTGATCTCAGTGTTCATCTAG -3'

Sequencing Primer
(F):5'- GTCCCTAGGGAGATTATATGACATAG -3'
(R):5'- CATCTAGATCTGCCCTAGGGAATG -3'
Posted On 2014-06-30