Incidental Mutation 'R1909:Pnpla7'
ID 210112
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Name patatin-like phospholipase domain containing 7
Synonyms NRE, E430013P11Rik
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 24866045-24944069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24887300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 48 (M48K)
Ref Sequence ENSEMBL: ENSMUSP00000117907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045295] [ENSMUST00000137913] [ENSMUST00000146153] [ENSMUST00000152777]
AlphaFold A2AJ88
Predicted Effect probably benign
Transcript: ENSMUST00000045295
AA Change: M340K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: M340K

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119442
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145508
Predicted Effect possibly damaging
Transcript: ENSMUST00000146153
AA Change: M48K

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117907
Gene: ENSMUSG00000036833
AA Change: M48K

DomainStartEndE-ValueType
Blast:cNMP 28 62 6e-7 BLAST
low complexity region 128 133 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152777
SMART Domains Protein: ENSMUSP00000122394
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
cNMP 89 179 4.98e0 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24,866,327 (GRCm39) critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24,870,236 (GRCm39) missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 24,906,575 (GRCm39) missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 24,940,905 (GRCm39) missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 24,940,985 (GRCm39) critical splice donor site probably null
IGL02280:Pnpla7 APN 2 24,901,589 (GRCm39) missense probably benign 0.00
IGL02629:Pnpla7 APN 2 24,940,957 (GRCm39) missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 24,940,288 (GRCm39) missense probably benign 0.24
IGL02931:Pnpla7 APN 2 24,905,241 (GRCm39) missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 24,905,301 (GRCm39) unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 24,932,151 (GRCm39) missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 24,901,618 (GRCm39) missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 24,901,618 (GRCm39) missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24,887,239 (GRCm39) nonsense probably null
R0064:Pnpla7 UTSW 2 24,887,239 (GRCm39) nonsense probably null
R0309:Pnpla7 UTSW 2 24,877,207 (GRCm39) missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24,885,305 (GRCm39) missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 24,942,313 (GRCm39) splice site probably null
R0565:Pnpla7 UTSW 2 24,870,129 (GRCm39) splice site probably benign
R0830:Pnpla7 UTSW 2 24,887,267 (GRCm39) missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24,872,135 (GRCm39) missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24,887,252 (GRCm39) missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 24,940,965 (GRCm39) missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24,886,177 (GRCm39) missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 24,937,720 (GRCm39) missense probably benign 0.01
R1572:Pnpla7 UTSW 2 24,905,263 (GRCm39) missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 24,942,611 (GRCm39) missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 24,930,985 (GRCm39) missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 24,943,796 (GRCm39) unclassified probably benign
R1973:Pnpla7 UTSW 2 24,906,629 (GRCm39) missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 24,941,610 (GRCm39) unclassified probably benign
R2381:Pnpla7 UTSW 2 24,870,770 (GRCm39) missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 24,942,330 (GRCm39) missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 24,932,150 (GRCm39) missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24,872,126 (GRCm39) missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 24,941,716 (GRCm39) nonsense probably null
R4573:Pnpla7 UTSW 2 24,940,885 (GRCm39) missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 24,942,329 (GRCm39) missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24,870,064 (GRCm39) missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24,870,064 (GRCm39) missense probably benign 0.05
R4893:Pnpla7 UTSW 2 24,943,688 (GRCm39) nonsense probably null
R4941:Pnpla7 UTSW 2 24,887,276 (GRCm39) splice site probably null
R5116:Pnpla7 UTSW 2 24,911,982 (GRCm39) missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24,870,056 (GRCm39) missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 24,931,115 (GRCm39) missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 24,940,321 (GRCm39) missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24,887,312 (GRCm39) missense probably benign 0.06
R5288:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 24,911,964 (GRCm39) missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 24,892,949 (GRCm39) missense probably benign 0.10
R5384:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 24,909,453 (GRCm39) missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 24,893,013 (GRCm39) missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 24,942,396 (GRCm39) missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24,871,790 (GRCm39) missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 24,901,661 (GRCm39) missense probably benign
R6284:Pnpla7 UTSW 2 24,906,630 (GRCm39) missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 24,901,576 (GRCm39) missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 24,906,550 (GRCm39) missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 24,941,627 (GRCm39) missense probably damaging 1.00
R7503:Pnpla7 UTSW 2 24,873,544 (GRCm39) nonsense probably null
R7526:Pnpla7 UTSW 2 24,888,678 (GRCm39) missense possibly damaging 0.52
R7791:Pnpla7 UTSW 2 24,942,078 (GRCm39) missense probably damaging 1.00
R8262:Pnpla7 UTSW 2 24,873,635 (GRCm39) missense probably damaging 1.00
R8283:Pnpla7 UTSW 2 24,940,935 (GRCm39) missense probably damaging 1.00
R8993:Pnpla7 UTSW 2 24,943,431 (GRCm39) missense possibly damaging 0.68
R9086:Pnpla7 UTSW 2 24,929,709 (GRCm39) missense probably damaging 1.00
R9229:Pnpla7 UTSW 2 24,873,503 (GRCm39) missense probably damaging 0.98
R9494:Pnpla7 UTSW 2 24,942,390 (GRCm39) nonsense probably null
R9651:Pnpla7 UTSW 2 24,892,931 (GRCm39) missense probably benign 0.02
Z1177:Pnpla7 UTSW 2 24,888,771 (GRCm39) missense probably null 0.06
Predicted Primers PCR Primer
(F):5'- TCTCTGAGCTGCCTGGATTC -3'
(R):5'- AAATCCTAGACCAAGAAATCTGGG -3'

Sequencing Primer
(F):5'- AGCTGCCTGGATTCCGAGTG -3'
(R):5'- TTGTAACCATGGGAGGAGCCTG -3'
Posted On 2014-06-30