Incidental Mutation 'R1909:Setx'
ID 210113
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Name senataxin
Synonyms Als4, A930037J23Rik
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 29014193-29072483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29053021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2095 (V2095A)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
AlphaFold A2AKX3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061578
AA Change: V2095A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: V2095A

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135992
Predicted Effect probably benign
Transcript: ENSMUST00000145422
SMART Domains Protein: ENSMUSP00000119176
Gene: ENSMUSG00000043535

DomainStartEndE-ValueType
Pfam:AAA_11 1 68 5.8e-26 PFAM
Pfam:AAA_12 75 331 4.5e-54 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29,038,457 (GRCm39) missense possibly damaging 0.50
IGL00806:Setx APN 2 29,017,038 (GRCm39) missense probably damaging 1.00
IGL01346:Setx APN 2 29,034,821 (GRCm39) missense probably damaging 1.00
IGL01623:Setx APN 2 29,053,021 (GRCm39) missense possibly damaging 0.70
IGL02351:Setx APN 2 29,036,976 (GRCm39) missense probably benign 0.45
IGL02358:Setx APN 2 29,036,976 (GRCm39) missense probably benign 0.45
IGL02378:Setx APN 2 29,063,738 (GRCm39) splice site probably benign
IGL02388:Setx APN 2 29,063,665 (GRCm39) missense probably damaging 1.00
IGL02408:Setx APN 2 29,023,942 (GRCm39) missense probably damaging 1.00
IGL02425:Setx APN 2 29,038,420 (GRCm39) missense probably benign 0.00
IGL03023:Setx APN 2 29,035,914 (GRCm39) missense probably benign 0.02
IGL03351:Setx APN 2 29,051,811 (GRCm39) missense probably benign 0.25
Addison UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
dallas UTSW 2 29,044,073 (GRCm39) frame shift probably null
Denton UTSW 2 29,035,072 (GRCm39) missense possibly damaging 0.81
doggie UTSW 2 29,054,562 (GRCm39) missense probably damaging 1.00
Irving UTSW 2 29,029,233 (GRCm39) missense probably damaging 0.99
G1Funyon:Setx UTSW 2 29,035,702 (GRCm39) missense possibly damaging 0.69
IGL03014:Setx UTSW 2 29,029,423 (GRCm39) missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29,023,967 (GRCm39) missense probably damaging 1.00
R0027:Setx UTSW 2 29,029,233 (GRCm39) missense probably damaging 0.99
R0031:Setx UTSW 2 29,066,941 (GRCm39) missense probably benign 0.02
R0070:Setx UTSW 2 29,051,537 (GRCm39) missense probably benign 0.00
R0070:Setx UTSW 2 29,051,537 (GRCm39) missense probably benign 0.00
R0092:Setx UTSW 2 29,036,305 (GRCm39) missense probably benign 0.00
R0193:Setx UTSW 2 29,069,685 (GRCm39) missense probably benign 0.21
R0281:Setx UTSW 2 29,069,655 (GRCm39) missense probably benign 0.00
R0401:Setx UTSW 2 29,056,301 (GRCm39) nonsense probably null
R0413:Setx UTSW 2 29,029,290 (GRCm39) missense probably damaging 1.00
R0517:Setx UTSW 2 29,047,145 (GRCm39) missense probably benign 0.00
R0536:Setx UTSW 2 29,048,260 (GRCm39) missense possibly damaging 0.46
R0617:Setx UTSW 2 29,036,819 (GRCm39) missense possibly damaging 0.86
R1183:Setx UTSW 2 29,070,104 (GRCm39) missense probably benign
R1331:Setx UTSW 2 29,069,698 (GRCm39) missense probably benign
R1465:Setx UTSW 2 29,030,401 (GRCm39) critical splice donor site probably null
R1465:Setx UTSW 2 29,030,401 (GRCm39) critical splice donor site probably null
R1467:Setx UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
R1467:Setx UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
R1482:Setx UTSW 2 29,053,004 (GRCm39) missense probably damaging 0.99
R1599:Setx UTSW 2 29,030,385 (GRCm39) missense probably benign 0.04
R1663:Setx UTSW 2 29,016,917 (GRCm39) missense probably damaging 1.00
R2117:Setx UTSW 2 29,020,313 (GRCm39) missense probably benign 0.01
R2207:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2221:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2223:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2223:Setx UTSW 2 29,038,549 (GRCm39) missense possibly damaging 0.89
R2273:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2274:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2275:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2309:Setx UTSW 2 29,048,916 (GRCm39) missense probably damaging 1.00
R2328:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2328:Setx UTSW 2 29,044,072 (GRCm39) frame shift probably null
R2329:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2331:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2332:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2429:Setx UTSW 2 29,069,910 (GRCm39) missense probably benign 0.00
R2438:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2439:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2496:Setx UTSW 2 29,034,813 (GRCm39) missense probably benign 0.11
R2858:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2859:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2884:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2885:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2886:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2915:Setx UTSW 2 29,062,336 (GRCm39) missense probably damaging 0.99
R2921:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2921:Setx UTSW 2 29,044,072 (GRCm39) small deletion probably benign
R2923:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3426:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3609:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3610:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3731:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3813:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3835:Setx UTSW 2 29,035,072 (GRCm39) missense possibly damaging 0.81
R3871:Setx UTSW 2 29,035,753 (GRCm39) missense probably damaging 0.98
R4013:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4014:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4015:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4017:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4246:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4248:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4297:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4298:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4539:Setx UTSW 2 29,069,760 (GRCm39) missense probably benign 0.14
R4590:Setx UTSW 2 29,034,821 (GRCm39) missense probably damaging 1.00
R4632:Setx UTSW 2 29,038,627 (GRCm39) missense probably benign 0.23
R4782:Setx UTSW 2 29,034,058 (GRCm39) missense probably damaging 0.99
R4801:Setx UTSW 2 29,036,385 (GRCm39) missense probably benign 0.14
R4802:Setx UTSW 2 29,036,385 (GRCm39) missense probably benign 0.14
R4975:Setx UTSW 2 29,054,562 (GRCm39) missense probably damaging 1.00
R5040:Setx UTSW 2 29,029,350 (GRCm39) missense probably damaging 1.00
R5133:Setx UTSW 2 29,070,093 (GRCm39) missense probably benign 0.02
R5208:Setx UTSW 2 29,056,379 (GRCm39) missense possibly damaging 0.63
R5237:Setx UTSW 2 29,036,995 (GRCm39) missense probably benign 0.00
R5248:Setx UTSW 2 29,038,430 (GRCm39) missense probably benign 0.26
R5288:Setx UTSW 2 29,024,045 (GRCm39) critical splice donor site probably null
R5385:Setx UTSW 2 29,024,045 (GRCm39) critical splice donor site probably null
R5387:Setx UTSW 2 29,037,606 (GRCm39) missense probably benign 0.00
R5407:Setx UTSW 2 29,035,486 (GRCm39) missense probably benign 0.00
R5685:Setx UTSW 2 29,061,292 (GRCm39) missense probably damaging 1.00
R6110:Setx UTSW 2 29,030,302 (GRCm39) missense probably damaging 1.00
R6136:Setx UTSW 2 29,038,039 (GRCm39) missense probably benign 0.01
R6310:Setx UTSW 2 29,066,947 (GRCm39) missense possibly damaging 0.57
R6328:Setx UTSW 2 29,064,474 (GRCm39) intron probably benign
R6358:Setx UTSW 2 29,061,360 (GRCm39) missense possibly damaging 0.79
R6384:Setx UTSW 2 29,063,570 (GRCm39) missense probably damaging 1.00
R6400:Setx UTSW 2 29,020,286 (GRCm39) missense probably damaging 0.97
R6572:Setx UTSW 2 29,063,706 (GRCm39) missense possibly damaging 0.63
R6662:Setx UTSW 2 29,048,126 (GRCm39) missense probably damaging 0.97
R6898:Setx UTSW 2 29,038,120 (GRCm39) missense probably benign 0.00
R7188:Setx UTSW 2 29,038,184 (GRCm39) missense probably benign 0.02
R7332:Setx UTSW 2 29,036,638 (GRCm39) missense probably benign 0.00
R7357:Setx UTSW 2 29,020,313 (GRCm39) missense probably benign 0.01
R7556:Setx UTSW 2 29,036,505 (GRCm39) missense possibly damaging 0.88
R7646:Setx UTSW 2 29,067,561 (GRCm39) missense possibly damaging 0.94
R7802:Setx UTSW 2 29,037,033 (GRCm39) missense probably benign 0.02
R7810:Setx UTSW 2 29,038,663 (GRCm39) missense probably benign 0.43
R7831:Setx UTSW 2 29,069,866 (GRCm39) missense possibly damaging 0.75
R7831:Setx UTSW 2 29,047,120 (GRCm39) missense probably damaging 1.00
R7843:Setx UTSW 2 29,063,581 (GRCm39) missense probably damaging 1.00
R7850:Setx UTSW 2 29,037,430 (GRCm39) missense probably damaging 1.00
R7858:Setx UTSW 2 29,051,562 (GRCm39) missense probably damaging 1.00
R8121:Setx UTSW 2 29,035,046 (GRCm39) missense possibly damaging 0.93
R8284:Setx UTSW 2 29,035,348 (GRCm39) missense possibly damaging 0.46
R8301:Setx UTSW 2 29,035,702 (GRCm39) missense possibly damaging 0.69
R8752:Setx UTSW 2 29,048,992 (GRCm39) missense probably damaging 0.97
R8785:Setx UTSW 2 29,035,275 (GRCm39) missense probably damaging 1.00
R8871:Setx UTSW 2 29,038,114 (GRCm39) missense probably benign 0.11
R8927:Setx UTSW 2 29,016,971 (GRCm39) missense possibly damaging 0.59
R8928:Setx UTSW 2 29,016,971 (GRCm39) missense possibly damaging 0.59
R9182:Setx UTSW 2 29,061,299 (GRCm39) missense probably damaging 1.00
R9334:Setx UTSW 2 29,044,032 (GRCm39) nonsense probably null
R9335:Setx UTSW 2 29,035,963 (GRCm39) missense probably benign 0.00
R9491:Setx UTSW 2 29,037,835 (GRCm39) missense probably benign 0.03
R9551:Setx UTSW 2 29,020,244 (GRCm39) missense possibly damaging 0.80
R9627:Setx UTSW 2 29,034,661 (GRCm39) missense probably damaging 1.00
R9688:Setx UTSW 2 29,036,328 (GRCm39) missense probably damaging 1.00
R9689:Setx UTSW 2 29,051,555 (GRCm39) missense probably damaging 1.00
R9747:Setx UTSW 2 29,064,377 (GRCm39) nonsense probably null
R9780:Setx UTSW 2 29,016,999 (GRCm39) missense possibly damaging 0.88
X0066:Setx UTSW 2 29,037,891 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATCAGGTGTGTAGAGCAG -3'
(R):5'- GCAACTCTCTATTTGCAGCTG -3'

Sequencing Primer
(F):5'- ATCAGGTGTGTAGAGCAGGGTTG -3'
(R):5'- GAAACTGGTTACTACTGGTCTATACC -3'
Posted On 2014-06-30