Incidental Mutation 'R1909:Lrp4'
ID 210117
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Name low density lipoprotein receptor-related protein 4
Synonyms 6430526J12Rik, Megf7, mdig
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.781) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 91287856-91344124 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91328753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1551 (V1551D)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
AlphaFold Q8VI56
Predicted Effect possibly damaging
Transcript: ENSMUST00000028689
AA Change: V1551D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: V1551D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Mga T A 2: 119,757,075 (GRCm39) H1018Q possibly damaging Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91,325,371 (GRCm39) missense probably benign
IGL00509:Lrp4 APN 2 91,316,519 (GRCm39) splice site probably benign
IGL01145:Lrp4 APN 2 91,317,396 (GRCm39) missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91,304,293 (GRCm39) missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91,341,898 (GRCm39) missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91,303,986 (GRCm39) missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91,307,896 (GRCm39) missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91,312,326 (GRCm39) critical splice donor site probably null
IGL01885:Lrp4 APN 2 91,331,452 (GRCm39) missense probably benign 0.05
IGL01909:Lrp4 APN 2 91,324,529 (GRCm39) missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91,336,404 (GRCm39) missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91,305,065 (GRCm39) missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91,338,927 (GRCm39) missense probably benign 0.05
IGL02431:Lrp4 APN 2 91,306,982 (GRCm39) missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91,304,347 (GRCm39) missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91,307,055 (GRCm39) missense probably benign 0.02
IGL02828:Lrp4 APN 2 91,305,639 (GRCm39) missense probably benign
IGL02832:Lrp4 APN 2 91,341,925 (GRCm39) missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91,305,161 (GRCm39) missense possibly damaging 0.76
artiodactyl UTSW 2 91,325,339 (GRCm39) missense probably damaging 0.99
bubalus UTSW 2 91,325,300 (GRCm39) missense possibly damaging 0.71
riverhorse UTSW 2 91,310,666 (GRCm39) missense probably damaging 1.00
wallow UTSW 2 91,308,043 (GRCm39) missense probably benign 0.09
F5770:Lrp4 UTSW 2 91,318,863 (GRCm39) missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91,301,548 (GRCm39) missense probably benign 0.22
R0037:Lrp4 UTSW 2 91,301,548 (GRCm39) missense probably benign 0.22
R0137:Lrp4 UTSW 2 91,325,327 (GRCm39) missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91,321,015 (GRCm39) missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91,308,079 (GRCm39) missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91,305,523 (GRCm39) splice site probably benign
R0827:Lrp4 UTSW 2 91,325,386 (GRCm39) missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91,317,372 (GRCm39) splice site probably benign
R1183:Lrp4 UTSW 2 91,307,864 (GRCm39) critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91,306,650 (GRCm39) missense probably benign 0.26
R1693:Lrp4 UTSW 2 91,322,698 (GRCm39) missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91,322,966 (GRCm39) missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91,328,708 (GRCm39) missense probably benign 0.15
R1908:Lrp4 UTSW 2 91,328,753 (GRCm39) missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91,327,700 (GRCm39) nonsense probably null
R1934:Lrp4 UTSW 2 91,310,777 (GRCm39) missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91,332,299 (GRCm39) missense probably benign 0.01
R2433:Lrp4 UTSW 2 91,336,360 (GRCm39) missense probably benign 0.00
R2698:Lrp4 UTSW 2 91,305,557 (GRCm39) missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91,321,075 (GRCm39) missense probably benign 0.01
R3105:Lrp4 UTSW 2 91,331,394 (GRCm39) missense probably benign
R3709:Lrp4 UTSW 2 91,320,811 (GRCm39) missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91,332,299 (GRCm39) missense probably benign 0.01
R3735:Lrp4 UTSW 2 91,328,716 (GRCm39) missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91,307,047 (GRCm39) missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91,304,294 (GRCm39) missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91,304,294 (GRCm39) missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91,342,015 (GRCm39) missense probably benign 0.20
R4741:Lrp4 UTSW 2 91,341,912 (GRCm39) missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91,316,231 (GRCm39) missense probably benign
R5050:Lrp4 UTSW 2 91,322,767 (GRCm39) missense probably benign 0.22
R5096:Lrp4 UTSW 2 91,316,137 (GRCm39) missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91,327,417 (GRCm39) missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91,309,023 (GRCm39) splice site probably benign
R5439:Lrp4 UTSW 2 91,327,418 (GRCm39) missense probably benign 0.14
R5725:Lrp4 UTSW 2 91,325,240 (GRCm39) missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91,304,816 (GRCm39) missense probably benign 0.01
R5820:Lrp4 UTSW 2 91,322,960 (GRCm39) missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91,318,778 (GRCm39) missense probably benign 0.01
R5919:Lrp4 UTSW 2 91,303,552 (GRCm39) missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91,342,029 (GRCm39) missense probably benign 0.01
R6080:Lrp4 UTSW 2 91,332,345 (GRCm39) missense probably benign
R6189:Lrp4 UTSW 2 91,305,579 (GRCm39) missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91,338,833 (GRCm39) missense probably benign 0.00
R6319:Lrp4 UTSW 2 91,310,666 (GRCm39) missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91,324,174 (GRCm39) missense probably benign 0.18
R6479:Lrp4 UTSW 2 91,317,429 (GRCm39) missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91,322,765 (GRCm39) missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91,332,340 (GRCm39) missense probably benign
R6657:Lrp4 UTSW 2 91,322,398 (GRCm39) missense probably benign 0.00
R6696:Lrp4 UTSW 2 91,327,690 (GRCm39) missense probably benign 0.03
R6714:Lrp4 UTSW 2 91,306,710 (GRCm39) missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91,316,242 (GRCm39) missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91,327,648 (GRCm39) missense probably benign 0.33
R6774:Lrp4 UTSW 2 91,341,849 (GRCm39) missense probably benign 0.01
R6957:Lrp4 UTSW 2 91,317,387 (GRCm39) missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91,322,343 (GRCm39) missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91,341,925 (GRCm39) missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91,325,339 (GRCm39) missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91,322,368 (GRCm39) missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91,303,528 (GRCm39) missense probably benign 0.04
R7387:Lrp4 UTSW 2 91,306,959 (GRCm39) missense probably benign
R7585:Lrp4 UTSW 2 91,322,933 (GRCm39) missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91,325,387 (GRCm39) missense possibly damaging 0.82
R7872:Lrp4 UTSW 2 91,321,061 (GRCm39) missense possibly damaging 0.54
R7968:Lrp4 UTSW 2 91,324,424 (GRCm39) missense possibly damaging 0.74
R8222:Lrp4 UTSW 2 91,305,086 (GRCm39) missense probably damaging 1.00
R8338:Lrp4 UTSW 2 91,322,713 (GRCm39) missense probably benign 0.15
R8342:Lrp4 UTSW 2 91,318,790 (GRCm39) missense probably damaging 1.00
R8435:Lrp4 UTSW 2 91,307,998 (GRCm39) missense probably damaging 1.00
R8720:Lrp4 UTSW 2 91,324,459 (GRCm39) missense probably damaging 1.00
R8774:Lrp4 UTSW 2 91,308,043 (GRCm39) missense probably benign 0.09
R8774-TAIL:Lrp4 UTSW 2 91,308,043 (GRCm39) missense probably benign 0.09
R8792:Lrp4 UTSW 2 91,325,300 (GRCm39) missense possibly damaging 0.71
R8913:Lrp4 UTSW 2 91,331,785 (GRCm39) missense probably benign 0.11
R9017:Lrp4 UTSW 2 91,324,397 (GRCm39) missense possibly damaging 0.51
R9062:Lrp4 UTSW 2 91,303,925 (GRCm39) missense possibly damaging 0.46
R9118:Lrp4 UTSW 2 91,308,927 (GRCm39) missense possibly damaging 0.91
R9640:Lrp4 UTSW 2 91,316,296 (GRCm39) missense probably benign 0.02
R9649:Lrp4 UTSW 2 91,338,914 (GRCm39) missense possibly damaging 0.46
R9708:Lrp4 UTSW 2 91,342,076 (GRCm39) missense probably benign 0.02
R9748:Lrp4 UTSW 2 91,316,116 (GRCm39) missense probably damaging 0.99
R9776:Lrp4 UTSW 2 91,316,179 (GRCm39) missense probably damaging 1.00
V7580:Lrp4 UTSW 2 91,318,863 (GRCm39) missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91,318,863 (GRCm39) missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91,318,863 (GRCm39) missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91,318,863 (GRCm39) missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91,331,407 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGTTCCCTGCTTATGAGTTACATTC -3'
(R):5'- GCCAGGCCTTCAAATGACAG -3'

Sequencing Primer
(F):5'- TGACCTCTCGTCAGGAGTG -3'
(R):5'- GGCCTTCAAATGACAGAACACGG -3'
Posted On 2014-06-30