Mutagenetix > Incidental Mutation

Incidental Mutation 'R1909:Mga'

210119

Institutional Source

Beutler Lab

Gene Symbol

Mga

Ensembl Gene

ENSMUSG00000033943

Gene Name

MAX gene associated

Synonyms

D030062C11Rik, Mga, Mad5, C130042M01Rik

MMRRC Submission

039928-MU

Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R1909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119897228-119969581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119926594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1018 (H1018Q)

Ref Sequence

ENSEMBL: ENSMUSP00000106400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046717
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: H1097Q

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	6e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1796	1818	N/A	INTRINSIC
low complexity region	1833	1850	N/A	INTRINSIC
low complexity region	1977	1992	N/A	INTRINSIC
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2241	2259	N/A	INTRINSIC
HLH	2368	2419	8.27e-7	SMART
low complexity region	2748	2769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079934
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: H1097Q

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART
low complexity region	2578	2599	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110773
AA Change: H1018Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: H1018Q

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	890	899	N/A	INTRINSIC
low complexity region	938	952	N/A	INTRINSIC
low complexity region	1033	1059	N/A	INTRINSIC
low complexity region	1169	1190	N/A	INTRINSIC
low complexity region	1222	1236	N/A	INTRINSIC
low complexity region	1485	1502	N/A	INTRINSIC
low complexity region	1555	1570	N/A	INTRINSIC
low complexity region	1602	1637	N/A	INTRINSIC
low complexity region	1717	1739	N/A	INTRINSIC
low complexity region	1754	1771	N/A	INTRINSIC
low complexity region	1898	1913	N/A	INTRINSIC
low complexity region	2104	2118	N/A	INTRINSIC
low complexity region	2162	2180	N/A	INTRINSIC
HLH	2289	2340	8.27e-7	SMART
low complexity region	2669	2690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110774
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: H1097Q

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	7e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
Pfam:DUF4801	1037	1085	1e-19	PFAM
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1835	1857	N/A	INTRINSIC
low complexity region	1872	1889	N/A	INTRINSIC
low complexity region	2016	2031	N/A	INTRINSIC
low complexity region	2222	2236	N/A	INTRINSIC
low complexity region	2280	2298	N/A	INTRINSIC
HLH	2407	2458	8.27e-7	SMART
low complexity region	2787	2808	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129405

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150742

Predicted Effect

probably benign
Transcript: ENSMUST00000156510
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: H1097Q

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	4e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	A	7: 34,258,036	I59L	probably benign	Het
9530053A07Rik	T	C	7: 28,144,348	V887A	possibly damaging	Het
Aarsd1	A	C	11: 101,410,231		probably null	Het
Abcc5	A	G	16: 20,376,509		probably null	Het
Abcc6	T	C	7: 46,020,134		probably null	Het
Adam15	C	A	3: 89,345,330	M317I	probably benign	Het
Ago3	T	C	4: 126,346,737	T111A	probably damaging	Het
Amz1	G	T	5: 140,752,461	S492I	probably benign	Het
Arid1a	T	C	4: 133,693,761	N911S	unknown	Het
Arntl2	A	T	6: 146,810,810	E111V	probably benign	Het
Ascl2	C	A	7: 142,968,163	A115S	probably damaging	Het
Ash1l	T	C	3: 88,984,528	V1238A	probably benign	Het
Asxl2	G	T	12: 3,474,577	V202F	probably damaging	Het
Atp10a	A	T	7: 58,828,712	Q1501L	probably benign	Het
Avpr1a	A	T	10: 122,452,208	I374L	probably benign	Het
Bmx	T	C	X: 164,239,415	H157R	probably benign	Het
Camk4	T	A	18: 33,158,816		probably null	Het
Ccdc103	G	A	11: 102,882,566	D5N	probably benign	Het
Ccdc186	A	T	19: 56,793,361	N70K	probably damaging	Het
Cebpz	A	T	17: 78,934,907	Y439*	probably null	Het
Cfap206	A	C	4: 34,722,714	S122R	probably benign	Het
Cnst	T	C	1: 179,622,791	S607P	probably damaging	Het
Col8a2	C	A	4: 126,312,133	D645E	possibly damaging	Het
Cpsf4l	A	T	11: 113,703,378		probably null	Het
Crim1	C	T	17: 78,313,127	T332I	probably benign	Het
Csmd1	A	T	8: 15,906,116	Y3364N	probably damaging	Het
D5Ertd579e	A	T	5: 36,614,058	S998T	probably benign	Het
Dab2ip	C	G	2: 35,718,815	A587G	probably damaging	Het
Dach1	C	T	14: 97,901,393	G486D	probably damaging	Het
Ddx24	T	C	12: 103,409,982	I752V	probably damaging	Het
Dhx33	A	G	11: 70,989,107	V359A	probably benign	Het
Dip2c	A	T	13: 9,533,350	T123S	probably benign	Het
Dync1h1	G	A	12: 110,662,629	E4207K	probably damaging	Het
Eef1b2	G	T	1: 63,177,272	D21Y	probably damaging	Het
Eif3b	T	C	5: 140,432,937	S462P	probably damaging	Het
Elmod2	G	C	8: 83,316,369	R277G	probably benign	Het
Epg5	T	A	18: 77,959,032	D555E	probably benign	Het
Ercc8	A	T	13: 108,175,566	K172*	probably null	Het
Fat3	T	C	9: 15,998,115	N2197S	probably benign	Het
Fbf1	A	G	11: 116,145,992	V972A	possibly damaging	Het
Fes	T	C	7: 80,386,861	R113G	probably damaging	Het
Fzd1	G	T	5: 4,757,481	H34N	probably benign	Het
Galnt17	T	A	5: 131,111,838	Y147F	probably benign	Het
Gdf6	T	C	4: 9,859,971	L351P	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm15448	A	T	7: 3,822,919	I317N	probably benign	Het
Gm2381	A	T	7: 42,819,928	H257Q	probably damaging	Het
Gm6904	A	T	14: 59,258,613	S17R	probably benign	Het
Gm9844	T	C	7: 24,862,306	I10T	possibly damaging	Het
Hivep1	A	T	13: 42,155,646	K454M	probably benign	Het
Hmmr	T	A	11: 40,708,098	E566D	probably damaging	Het
Hydin	T	G	8: 110,587,772	V4296G	probably damaging	Het
Il18r1	T	A	1: 40,474,914	D93E	probably damaging	Het
Iqgap1	T	C	7: 80,743,828	D667G	probably benign	Het
Lama3	T	C	18: 12,581,798	I3278T	probably benign	Het
Lrp4	T	A	2: 91,498,408	V1551D	possibly damaging	Het
Mdn1	CGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAG	4: 32,760,839		probably benign	Het
Ncoa7	A	T	10: 30,689,800	M666K	probably damaging	Het
Ndnf	T	G	6: 65,703,313	V192G	possibly damaging	Het
Nr4a1	T	A	15: 101,274,227	I594N	probably damaging	Het
Olfr1294	T	A	2: 111,538,014	I92F	probably damaging	Het
Olfr60	T	C	7: 140,345,465	I175V	probably benign	Het
Olfr618	A	G	7: 103,597,343	N9S	probably benign	Het
Olfr635	G	A	7: 103,979,790	W199*	probably null	Het
Olfr698	T	C	7: 106,752,995	N131S	probably benign	Het
Paxbp1	T	C	16: 91,044,305		probably benign	Het
Pcdhb8	A	G	18: 37,355,962	E231G	possibly damaging	Het
Pcsk5	A	T	19: 17,433,461	Y1856N	probably benign	Het
Pde3a	T	C	6: 141,250,239	V217A	probably benign	Het
Pirb	A	T	7: 3,714,588	D674E	probably benign	Het
Pnisr	T	A	4: 21,869,517	M335K	possibly damaging	Het
Pnpla7	T	A	2: 24,997,288	M48K	possibly damaging	Het
Pomgnt2	A	T	9: 121,982,191	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkca	A	T	11: 107,939,612	D217E	possibly damaging	Het
Rac3	A	C	11: 120,723,337	I142L	probably benign	Het
Ralgapb	G	T	2: 158,444,675	A347S	probably damaging	Het
Rbm43	G	C	2: 51,925,434	S258R	possibly damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Rsph10b	T	C	5: 143,985,491	F409L	probably benign	Het
Ryr2	A	T	13: 11,700,349	L2778M	probably damaging	Het
Scn1a	T	C	2: 66,331,352	N284S	possibly damaging	Het
Scyl2	A	T	10: 89,640,905	M786K	probably benign	Het
Sema4g	C	A	19: 44,997,622	R301S	probably damaging	Het
Senp6	A	T	9: 80,113,774	E245D	possibly damaging	Het
Setx	T	C	2: 29,163,009	V2095A	possibly damaging	Het
Slc13a2	A	T	11: 78,400,142	M412K	possibly damaging	Het
Slc25a4	T	C	8: 46,209,400	N74D	probably damaging	Het
Slc28a1	T	A	7: 81,142,035	F316L	probably damaging	Het
Slfn8	G	A	11: 83,003,621	Q731*	probably null	Het
Slitrk4	A	G	X: 64,272,623	I146T	probably damaging	Het
Smg1	A	G	7: 118,154,199		probably benign	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Smyd1	T	A	6: 71,239,579	K61N	probably benign	Het
Sod2	T	C	17: 13,015,169	*223R	probably null	Het
Sp6	G	T	11: 97,021,508	A16S	probably benign	Het
Spata31d1a	A	C	13: 59,702,695	Y540D	probably damaging	Het
Spatc1l	A	G	10: 76,563,917	D91G	probably damaging	Het
Spg7	A	G	8: 123,080,741	T419A	probably benign	Het
St5	G	A	7: 109,525,326	Q686*	probably null	Het
St8sia4	A	G	1: 95,627,573	I244T	probably damaging	Het
Tbl2	C	T	5: 135,152,991	R27W	probably damaging	Het
Tmed4	G	A	11: 6,274,694	P47L	probably damaging	Het
Tmtc1	T	C	6: 148,444,048	D51G	possibly damaging	Het
Ttc28	T	C	5: 111,284,054		probably null	Het
Unc13d	A	G	11: 116,070,295	F412S	probably damaging	Het
Unc45b	A	C	11: 82,926,087	K451T	probably damaging	Het
Vmn2r16	A	G	5: 109,363,987	M687V	probably benign	Het
Vmn2r68	T	A	7: 85,234,052	H164L	probably benign	Het
Vps51	A	G	19: 6,069,469	V625A	probably benign	Het
Wapl	T	A	14: 34,691,912	W244R	probably damaging	Het
Wdr75	C	T	1: 45,823,403	T794I	probably benign	Het

Other mutations in Mga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Mga	APN	2	119919814	missense	possibly damaging	0.65
IGL00719:Mga	APN	2	119947453	nonsense	probably null
IGL01619:Mga	APN	2	119931828	missense	possibly damaging	0.46
IGL01721:Mga	APN	2	119935239	missense	probably damaging	1.00
IGL01759:Mga	APN	2	119951195	missense	possibly damaging	0.92
IGL01785:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01786:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01950:Mga	APN	2	119941654	missense	possibly damaging	0.60
IGL01960:Mga	APN	2	119938657	missense	probably damaging	1.00
IGL02086:Mga	APN	2	119924036	missense	probably damaging	0.99
IGL02364:Mga	APN	2	119964054	missense	possibly damaging	0.66
IGL02602:Mga	APN	2	119931884	missense	possibly damaging	0.66
IGL02751:Mga	APN	2	119947770	missense	possibly damaging	0.82
IGL02794:Mga	APN	2	119946289	missense	possibly damaging	0.84
IGL03247:Mga	APN	2	119935513	missense	possibly damaging	0.81
IGL03303:Mga	APN	2	119903452	missense	probably damaging	1.00
PIT4515001:Mga	UTSW	2	119916504	missense	probably damaging	1.00
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0417:Mga	UTSW	2	119902790	missense	probably damaging	0.99
R0449:Mga	UTSW	2	119941381	missense	probably damaging	1.00
R0457:Mga	UTSW	2	119916488	missense	probably damaging	0.98
R0538:Mga	UTSW	2	119919706	critical splice donor site	probably null
R0568:Mga	UTSW	2	119935422	missense	probably damaging	1.00
R0614:Mga	UTSW	2	119964466	missense	probably damaging	1.00
R0671:Mga	UTSW	2	119919910	splice site	probably null
R0811:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0812:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0948:Mga	UTSW	2	119941659	missense	possibly damaging	0.77
R1177:Mga	UTSW	2	119926446	missense	probably damaging	1.00
R1445:Mga	UTSW	2	119902698	missense	probably damaging	1.00
R1476:Mga	UTSW	2	119941675	missense	probably damaging	0.96
R1527:Mga	UTSW	2	119916597	missense	probably damaging	1.00
R1583:Mga	UTSW	2	119963960	missense	possibly damaging	0.66
R1592:Mga	UTSW	2	119964666	missense	possibly damaging	0.93
R1627:Mga	UTSW	2	119964562	missense	probably damaging	1.00
R1658:Mga	UTSW	2	119941689	missense	possibly damaging	0.63
R1677:Mga	UTSW	2	119960852	missense	possibly damaging	0.92
R1887:Mga	UTSW	2	119923617	missense	probably damaging	1.00
R1908:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R2061:Mga	UTSW	2	119964980	unclassified	probably benign
R2145:Mga	UTSW	2	119964157	missense	possibly damaging	0.85
R2159:Mga	UTSW	2	119919643	missense	probably damaging	0.96
R2179:Mga	UTSW	2	119960442	missense	probably damaging	0.99
R2281:Mga	UTSW	2	119903723	missense	probably benign
R2423:Mga	UTSW	2	119964793	missense	probably damaging	1.00
R3620:Mga	UTSW	2	119916668	missense	probably damaging	1.00
R3622:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3624:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3802:Mga	UTSW	2	119947339	missense	probably damaging	0.96
R4011:Mga	UTSW	2	119931780	missense	probably damaging	1.00
R4065:Mga	UTSW	2	119947002	missense	probably damaging	1.00
R4520:Mga	UTSW	2	119948098	missense	possibly damaging	0.85
R4649:Mga	UTSW	2	119941493	missense	possibly damaging	0.81
R4660:Mga	UTSW	2	119938623	intron	probably benign
R4757:Mga	UTSW	2	119903639	missense	possibly damaging	0.82
R4771:Mga	UTSW	2	119964294	missense	probably damaging	1.00
R4784:Mga	UTSW	2	119903057	missense	probably damaging	1.00
R4866:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4900:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4952:Mga	UTSW	2	119903301	missense	probably damaging	1.00
R4995:Mga	UTSW	2	119932582	nonsense	probably null
R5020:Mga	UTSW	2	119951173	nonsense	probably null
R5082:Mga	UTSW	2	119903344	missense	probably damaging	0.98
R5208:Mga	UTSW	2	119947981	missense	possibly damaging	0.83
R5454:Mga	UTSW	2	119903329	missense	probably damaging	0.99
R5466:Mga	UTSW	2	119902697	missense	probably damaging	1.00
R5484:Mga	UTSW	2	119916626	missense	possibly damaging	0.58
R5669:Mga	UTSW	2	119903426	missense	probably damaging	1.00
R5819:Mga	UTSW	2	119941263	missense	possibly damaging	0.61
R5916:Mga	UTSW	2	119964312	missense	probably benign	0.27
R5942:Mga	UTSW	2	119946959	missense	probably benign	0.41
R6305:Mga	UTSW	2	119947698	missense	probably benign	0.00
R6434:Mga	UTSW	2	119923938	missense	probably damaging	0.99
R6467:Mga	UTSW	2	119946295	missense	probably damaging	1.00
R6488:Mga	UTSW	2	119960907	missense	probably damaging	1.00
R6630:Mga	UTSW	2	119923659	missense	probably damaging	0.99
R6790:Mga	UTSW	2	119923754	missense	probably damaging	0.99
R7029:Mga	UTSW	2	119923550	missense	probably damaging	1.00
R7039:Mga	UTSW	2	119932678	missense	probably benign	0.28
R7088:Mga	UTSW	2	119961936	missense	probably damaging	1.00
R7195:Mga	UTSW	2	119917328	missense	probably damaging	1.00
R7273:Mga	UTSW	2	119935214	missense	probably damaging	1.00
R7286:Mga	UTSW	2	119964788	missense	possibly damaging	0.93
R7346:Mga	UTSW	2	119935527	missense	possibly damaging	0.56
R7383:Mga	UTSW	2	119960340	missense	probably damaging	0.99
R7469:Mga	UTSW	2	119903046	missense	probably damaging	1.00
R7484:Mga	UTSW	2	119946229	missense	probably damaging	0.99
R7537:Mga	UTSW	2	119935551	missense	probably damaging	0.97
R7781:Mga	UTSW	2	119917357	missense	probably damaging	1.00
R7921:Mga	UTSW	2	119919678	missense	probably damaging	1.00
R8165:Mga	UTSW	2	119947238	missense	probably benign	0.12
R8226:Mga	UTSW	2	119960385	missense	probably benign	0.33
R8305:Mga	UTSW	2	119946319	missense	possibly damaging	0.77
R8309:Mga	UTSW	2	119960930	missense	probably damaging	1.00
R8363:Mga	UTSW	2	119963926	missense	probably benign	0.43
R8388:Mga	UTSW	2	119964081	missense	probably benign	0.00
R8524:Mga	UTSW	2	119941516	missense	probably damaging	0.97
R8693:Mga	UTSW	2	119963926	missense	possibly damaging	0.65
R8837:Mga	UTSW	2	119938791	splice site	probably benign
R8916:Mga	UTSW	2	119958338	missense	possibly damaging	0.92
R8936:Mga	UTSW	2	119964228	missense	probably damaging	1.00
R9028:Mga	UTSW	2	119947589	missense	probably benign
R9145:Mga	UTSW	2	119964012	missense	probably benign
R9155:Mga	UTSW	2	119926532	missense	probably damaging	1.00
R9308:Mga	UTSW	2	119923888	missense	possibly damaging	0.91
R9342:Mga	UTSW	2	119948175	missense	probably benign
R9347:Mga	UTSW	2	119903037	missense	probably damaging	1.00
R9390:Mga	UTSW	2	119963851	missense	probably damaging	0.99
R9408:Mga	UTSW	2	119935518	missense	possibly damaging	0.92
R9488:Mga	UTSW	2	119964823	missense	possibly damaging	0.90
R9495:Mga	UTSW	2	119951195	missense	possibly damaging	0.92
R9521:Mga	UTSW	2	119964498	missense	probably damaging	0.99
R9780:Mga	UTSW	2	119916772	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GAGCTCCTCCATGCAACAATG -3'
(R):5'- GTGAGGAAAATACATGACTTCAACC -3'

Sequencing Primer
(F):5'- ATGCAACAATGACTTCTGTCGC -3'
(R):5'- CCTCTACATACATTCACAGAAATGAG -3'

Posted On

2014-06-30