Incidental Mutation 'R1909:Mga'
ID 210119
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms Mga, C130042M01Rik, Mad5, D030062C11Rik
MMRRC Submission 039928-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R1909 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119727709-119800062 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119757075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1018 (H1018Q)
Ref Sequence ENSEMBL: ENSMUSP00000106400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046717
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: H1097Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079934
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: H1097Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: H1018Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: H1018Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110774
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: H1097Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150742
Predicted Effect probably benign
Transcript: ENSMUST00000156510
AA Change: H1097Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: H1097Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A C 11: 101,301,057 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,259 (GRCm39) probably null Het
Abcc6 T C 7: 45,669,558 (GRCm39) probably null Het
Adam15 C A 3: 89,252,637 (GRCm39) M317I probably benign Het
Ago3 T C 4: 126,240,530 (GRCm39) T111A probably damaging Het
Amz1 G T 5: 140,738,216 (GRCm39) S492I probably benign Het
Arid1a T C 4: 133,421,072 (GRCm39) N911S unknown Het
Ascl2 C A 7: 142,521,900 (GRCm39) A115S probably damaging Het
Ash1l T C 3: 88,891,835 (GRCm39) V1238A probably benign Het
Asxl2 G T 12: 3,524,577 (GRCm39) V202F probably damaging Het
Atp10a A T 7: 58,478,460 (GRCm39) Q1501L probably benign Het
Avpr1a A T 10: 122,288,113 (GRCm39) I374L probably benign Het
Bmal2 A T 6: 146,712,308 (GRCm39) E111V probably benign Het
Bmx T C X: 163,022,411 (GRCm39) H157R probably benign Het
Camk4 T A 18: 33,291,869 (GRCm39) probably null Het
Ccdc103 G A 11: 102,773,392 (GRCm39) D5N probably benign Het
Ccdc186 A T 19: 56,781,793 (GRCm39) N70K probably damaging Het
Cebpz A T 17: 79,242,336 (GRCm39) Y439* probably null Het
Cfap206 A C 4: 34,722,714 (GRCm39) S122R probably benign Het
Cnst T C 1: 179,450,356 (GRCm39) S607P probably damaging Het
Col8a2 C A 4: 126,205,926 (GRCm39) D645E possibly damaging Het
Cpsf4l A T 11: 113,594,204 (GRCm39) probably null Het
Crim1 C T 17: 78,620,556 (GRCm39) T332I probably benign Het
Csmd1 A T 8: 15,956,116 (GRCm39) Y3364N probably damaging Het
D5Ertd579e A T 5: 36,771,402 (GRCm39) S998T probably benign Het
Dab2ip C G 2: 35,608,827 (GRCm39) A587G probably damaging Het
Dach1 C T 14: 98,138,829 (GRCm39) G486D probably damaging Het
Ddx24 T C 12: 103,376,241 (GRCm39) I752V probably damaging Het
Dennd2b G A 7: 109,124,533 (GRCm39) Q686* probably null Het
Dhx33 A G 11: 70,879,933 (GRCm39) V359A probably benign Het
Dip2c A T 13: 9,583,386 (GRCm39) T123S probably benign Het
Dync1h1 G A 12: 110,629,063 (GRCm39) E4207K probably damaging Het
Eef1b2 G T 1: 63,216,431 (GRCm39) D21Y probably damaging Het
Eif3b T C 5: 140,418,692 (GRCm39) S462P probably damaging Het
Elmod2 G C 8: 84,042,998 (GRCm39) R277G probably benign Het
Epg5 T A 18: 78,002,247 (GRCm39) D555E probably benign Het
Ercc8 A T 13: 108,312,100 (GRCm39) K172* probably null Het
Fat3 T C 9: 15,909,411 (GRCm39) N2197S probably benign Het
Fbf1 A G 11: 116,036,818 (GRCm39) V972A possibly damaging Het
Fcgbpl1 T C 7: 27,843,773 (GRCm39) V887A possibly damaging Het
Fes T C 7: 80,036,609 (GRCm39) R113G probably damaging Het
Fzd1 G T 5: 4,807,481 (GRCm39) H34N probably benign Het
Galnt17 T A 5: 131,140,676 (GRCm39) Y147F probably benign Het
Garre1 T A 7: 33,957,461 (GRCm39) I59L probably benign Het
Gdf6 T C 4: 9,859,971 (GRCm39) L351P probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm2381 A T 7: 42,469,352 (GRCm39) H257Q probably damaging Het
Hivep1 A T 13: 42,309,122 (GRCm39) K454M probably benign Het
Hmmr T A 11: 40,598,925 (GRCm39) E566D probably damaging Het
Hydin T G 8: 111,314,404 (GRCm39) V4296G probably damaging Het
Il18r1 T A 1: 40,514,074 (GRCm39) D93E probably damaging Het
Iqgap1 T C 7: 80,393,576 (GRCm39) D667G probably benign Het
Lama3 T C 18: 12,714,855 (GRCm39) I3278T probably benign Het
Lrp4 T A 2: 91,328,753 (GRCm39) V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 (GRCm39) probably benign Het
Ncoa7 A T 10: 30,565,796 (GRCm39) M666K probably damaging Het
Ndnf T G 6: 65,680,297 (GRCm39) V192G possibly damaging Het
Nr4a1 T A 15: 101,172,108 (GRCm39) I594N probably damaging Het
Or13a27 T C 7: 139,925,378 (GRCm39) I175V probably benign Het
Or2ag16 T C 7: 106,352,202 (GRCm39) N131S probably benign Het
Or4k44 T A 2: 111,368,359 (GRCm39) I92F probably damaging Het
Or51q1 G A 7: 103,628,997 (GRCm39) W199* probably null Het
Or52z13 A G 7: 103,246,550 (GRCm39) N9S probably benign Het
Paxbp1 T C 16: 90,841,193 (GRCm39) probably benign Het
Pcdhb8 A G 18: 37,489,015 (GRCm39) E231G possibly damaging Het
Pcsk5 A T 19: 17,410,825 (GRCm39) Y1856N probably benign Het
Pde3a T C 6: 141,195,965 (GRCm39) V217A probably benign Het
Phf11 A T 14: 59,496,062 (GRCm39) S17R probably benign Het
Pira13 A T 7: 3,825,918 (GRCm39) I317N probably benign Het
Pirb A T 7: 3,717,587 (GRCm39) D674E probably benign Het
Pnisr T A 4: 21,869,517 (GRCm39) M335K possibly damaging Het
Pnpla7 T A 2: 24,887,300 (GRCm39) M48K possibly damaging Het
Pomgnt2 A T 9: 121,811,257 (GRCm39) I508N possibly damaging Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Prkca A T 11: 107,830,438 (GRCm39) D217E possibly damaging Het
Rac3 A C 11: 120,614,163 (GRCm39) I142L probably benign Het
Ralgapb G T 2: 158,286,595 (GRCm39) A347S probably damaging Het
Rbm43 G C 2: 51,815,446 (GRCm39) S258R possibly damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Rsph10b T C 5: 143,922,309 (GRCm39) F409L probably benign Het
Ryr2 A T 13: 11,715,235 (GRCm39) L2778M probably damaging Het
Scn1a T C 2: 66,161,696 (GRCm39) N284S possibly damaging Het
Scyl2 A T 10: 89,476,767 (GRCm39) M786K probably benign Het
Sema4g C A 19: 44,986,061 (GRCm39) R301S probably damaging Het
Senp6 A T 9: 80,021,056 (GRCm39) E245D possibly damaging Het
Setx T C 2: 29,053,021 (GRCm39) V2095A possibly damaging Het
Slc13a2 A T 11: 78,290,968 (GRCm39) M412K possibly damaging Het
Slc25a4 T C 8: 46,662,437 (GRCm39) N74D probably damaging Het
Slc28a1 T A 7: 80,791,783 (GRCm39) F316L probably damaging Het
Slfn8 G A 11: 82,894,447 (GRCm39) Q731* probably null Het
Slitrk4 A G X: 63,316,229 (GRCm39) I146T probably damaging Het
Smg1 A G 7: 117,753,422 (GRCm39) probably benign Het
Smg8 G T 11: 86,971,439 (GRCm39) Y777* probably null Het
Smyd1 T A 6: 71,216,563 (GRCm39) K61N probably benign Het
Sod2 T C 17: 13,234,056 (GRCm39) *223R probably null Het
Sp6 G T 11: 96,912,334 (GRCm39) A16S probably benign Het
Spata31d1a A C 13: 59,850,509 (GRCm39) Y540D probably damaging Het
Spatc1l A G 10: 76,399,751 (GRCm39) D91G probably damaging Het
Spg7 A G 8: 123,807,480 (GRCm39) T419A probably benign Het
St8sia4 A G 1: 95,555,298 (GRCm39) I244T probably damaging Het
Tbl2 C T 5: 135,181,845 (GRCm39) R27W probably damaging Het
Tmed4 G A 11: 6,224,694 (GRCm39) P47L probably damaging Het
Tmsb10b T C 7: 24,561,731 (GRCm39) I10T possibly damaging Het
Tmtc1 T C 6: 148,345,546 (GRCm39) D51G possibly damaging Het
Ttc28 T C 5: 111,431,920 (GRCm39) probably null Het
Unc13d A G 11: 115,961,121 (GRCm39) F412S probably damaging Het
Unc45b A C 11: 82,816,913 (GRCm39) K451T probably damaging Het
Vmn2r16 A G 5: 109,511,853 (GRCm39) M687V probably benign Het
Vmn2r68 T A 7: 84,883,260 (GRCm39) H164L probably benign Het
Vps51 A G 19: 6,119,499 (GRCm39) V625A probably benign Het
Wapl T A 14: 34,413,869 (GRCm39) W244R probably damaging Het
Wdr75 C T 1: 45,862,563 (GRCm39) T794I probably benign Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119,750,295 (GRCm39) missense possibly damaging 0.65
IGL00719:Mga APN 2 119,777,934 (GRCm39) nonsense probably null
IGL01619:Mga APN 2 119,762,309 (GRCm39) missense possibly damaging 0.46
IGL01721:Mga APN 2 119,765,720 (GRCm39) missense probably damaging 1.00
IGL01759:Mga APN 2 119,781,676 (GRCm39) missense possibly damaging 0.92
IGL01785:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01786:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01950:Mga APN 2 119,772,135 (GRCm39) missense possibly damaging 0.60
IGL01960:Mga APN 2 119,769,138 (GRCm39) missense probably damaging 1.00
IGL02086:Mga APN 2 119,754,517 (GRCm39) missense probably damaging 0.99
IGL02364:Mga APN 2 119,794,535 (GRCm39) missense possibly damaging 0.66
IGL02602:Mga APN 2 119,762,365 (GRCm39) missense possibly damaging 0.66
IGL02751:Mga APN 2 119,778,251 (GRCm39) missense possibly damaging 0.82
IGL02794:Mga APN 2 119,776,770 (GRCm39) missense possibly damaging 0.84
IGL03247:Mga APN 2 119,765,994 (GRCm39) missense possibly damaging 0.81
IGL03303:Mga APN 2 119,733,933 (GRCm39) missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119,746,985 (GRCm39) missense probably damaging 1.00
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0417:Mga UTSW 2 119,733,271 (GRCm39) missense probably damaging 0.99
R0449:Mga UTSW 2 119,771,862 (GRCm39) missense probably damaging 1.00
R0457:Mga UTSW 2 119,746,969 (GRCm39) missense probably damaging 0.98
R0538:Mga UTSW 2 119,750,187 (GRCm39) critical splice donor site probably null
R0568:Mga UTSW 2 119,765,903 (GRCm39) missense probably damaging 1.00
R0614:Mga UTSW 2 119,794,947 (GRCm39) missense probably damaging 1.00
R0671:Mga UTSW 2 119,750,391 (GRCm39) splice site probably null
R0811:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0812:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0948:Mga UTSW 2 119,772,140 (GRCm39) missense possibly damaging 0.77
R1177:Mga UTSW 2 119,756,927 (GRCm39) missense probably damaging 1.00
R1445:Mga UTSW 2 119,733,179 (GRCm39) missense probably damaging 1.00
R1476:Mga UTSW 2 119,772,156 (GRCm39) missense probably damaging 0.96
R1527:Mga UTSW 2 119,747,078 (GRCm39) missense probably damaging 1.00
R1583:Mga UTSW 2 119,794,441 (GRCm39) missense possibly damaging 0.66
R1592:Mga UTSW 2 119,795,147 (GRCm39) missense possibly damaging 0.93
R1627:Mga UTSW 2 119,795,043 (GRCm39) missense probably damaging 1.00
R1658:Mga UTSW 2 119,772,170 (GRCm39) missense possibly damaging 0.63
R1677:Mga UTSW 2 119,791,333 (GRCm39) missense possibly damaging 0.92
R1887:Mga UTSW 2 119,754,098 (GRCm39) missense probably damaging 1.00
R1908:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R2061:Mga UTSW 2 119,795,461 (GRCm39) unclassified probably benign
R2145:Mga UTSW 2 119,794,638 (GRCm39) missense possibly damaging 0.85
R2159:Mga UTSW 2 119,750,124 (GRCm39) missense probably damaging 0.96
R2179:Mga UTSW 2 119,790,923 (GRCm39) missense probably damaging 0.99
R2281:Mga UTSW 2 119,734,204 (GRCm39) missense probably benign
R2423:Mga UTSW 2 119,795,274 (GRCm39) missense probably damaging 1.00
R3620:Mga UTSW 2 119,747,149 (GRCm39) missense probably damaging 1.00
R3622:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3624:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3802:Mga UTSW 2 119,777,820 (GRCm39) missense probably damaging 0.96
R4011:Mga UTSW 2 119,762,261 (GRCm39) missense probably damaging 1.00
R4065:Mga UTSW 2 119,777,483 (GRCm39) missense probably damaging 1.00
R4520:Mga UTSW 2 119,778,579 (GRCm39) missense possibly damaging 0.85
R4649:Mga UTSW 2 119,771,974 (GRCm39) missense possibly damaging 0.81
R4660:Mga UTSW 2 119,769,104 (GRCm39) intron probably benign
R4757:Mga UTSW 2 119,734,120 (GRCm39) missense possibly damaging 0.82
R4771:Mga UTSW 2 119,794,775 (GRCm39) missense probably damaging 1.00
R4784:Mga UTSW 2 119,733,538 (GRCm39) missense probably damaging 1.00
R4866:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4900:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4952:Mga UTSW 2 119,733,782 (GRCm39) missense probably damaging 1.00
R4995:Mga UTSW 2 119,763,063 (GRCm39) nonsense probably null
R5020:Mga UTSW 2 119,781,654 (GRCm39) nonsense probably null
R5082:Mga UTSW 2 119,733,825 (GRCm39) missense probably damaging 0.98
R5208:Mga UTSW 2 119,778,462 (GRCm39) missense possibly damaging 0.83
R5454:Mga UTSW 2 119,733,810 (GRCm39) missense probably damaging 0.99
R5466:Mga UTSW 2 119,733,178 (GRCm39) missense probably damaging 1.00
R5484:Mga UTSW 2 119,747,107 (GRCm39) missense possibly damaging 0.58
R5669:Mga UTSW 2 119,733,907 (GRCm39) missense probably damaging 1.00
R5819:Mga UTSW 2 119,771,744 (GRCm39) missense possibly damaging 0.61
R5916:Mga UTSW 2 119,794,793 (GRCm39) missense probably benign 0.27
R5942:Mga UTSW 2 119,777,440 (GRCm39) missense probably benign 0.41
R6305:Mga UTSW 2 119,778,179 (GRCm39) missense probably benign 0.00
R6434:Mga UTSW 2 119,754,419 (GRCm39) missense probably damaging 0.99
R6467:Mga UTSW 2 119,776,776 (GRCm39) missense probably damaging 1.00
R6488:Mga UTSW 2 119,791,388 (GRCm39) missense probably damaging 1.00
R6630:Mga UTSW 2 119,754,140 (GRCm39) missense probably damaging 0.99
R6790:Mga UTSW 2 119,754,235 (GRCm39) missense probably damaging 0.99
R7029:Mga UTSW 2 119,754,031 (GRCm39) missense probably damaging 1.00
R7039:Mga UTSW 2 119,763,159 (GRCm39) missense probably benign 0.28
R7088:Mga UTSW 2 119,792,417 (GRCm39) missense probably damaging 1.00
R7195:Mga UTSW 2 119,747,809 (GRCm39) missense probably damaging 1.00
R7273:Mga UTSW 2 119,765,695 (GRCm39) missense probably damaging 1.00
R7286:Mga UTSW 2 119,795,269 (GRCm39) missense possibly damaging 0.93
R7346:Mga UTSW 2 119,766,008 (GRCm39) missense possibly damaging 0.56
R7383:Mga UTSW 2 119,790,821 (GRCm39) missense probably damaging 0.99
R7469:Mga UTSW 2 119,733,527 (GRCm39) missense probably damaging 1.00
R7484:Mga UTSW 2 119,776,710 (GRCm39) missense probably damaging 0.99
R7537:Mga UTSW 2 119,766,032 (GRCm39) missense probably damaging 0.97
R7781:Mga UTSW 2 119,747,838 (GRCm39) missense probably damaging 1.00
R7921:Mga UTSW 2 119,750,159 (GRCm39) missense probably damaging 1.00
R8165:Mga UTSW 2 119,777,719 (GRCm39) missense probably benign 0.12
R8226:Mga UTSW 2 119,790,866 (GRCm39) missense probably benign 0.33
R8305:Mga UTSW 2 119,776,800 (GRCm39) missense possibly damaging 0.77
R8309:Mga UTSW 2 119,791,411 (GRCm39) missense probably damaging 1.00
R8363:Mga UTSW 2 119,794,407 (GRCm39) missense probably benign 0.43
R8388:Mga UTSW 2 119,794,562 (GRCm39) missense probably benign 0.00
R8524:Mga UTSW 2 119,771,997 (GRCm39) missense probably damaging 0.97
R8693:Mga UTSW 2 119,794,407 (GRCm39) missense possibly damaging 0.65
R8837:Mga UTSW 2 119,769,272 (GRCm39) splice site probably benign
R8916:Mga UTSW 2 119,788,819 (GRCm39) missense possibly damaging 0.92
R8936:Mga UTSW 2 119,794,709 (GRCm39) missense probably damaging 1.00
R9028:Mga UTSW 2 119,778,070 (GRCm39) missense probably benign
R9145:Mga UTSW 2 119,794,493 (GRCm39) missense probably benign
R9155:Mga UTSW 2 119,757,013 (GRCm39) missense probably damaging 1.00
R9308:Mga UTSW 2 119,754,369 (GRCm39) missense possibly damaging 0.91
R9342:Mga UTSW 2 119,778,656 (GRCm39) missense probably benign
R9347:Mga UTSW 2 119,733,518 (GRCm39) missense probably damaging 1.00
R9390:Mga UTSW 2 119,794,332 (GRCm39) missense probably damaging 0.99
R9408:Mga UTSW 2 119,765,999 (GRCm39) missense possibly damaging 0.92
R9488:Mga UTSW 2 119,795,304 (GRCm39) missense possibly damaging 0.90
R9495:Mga UTSW 2 119,781,676 (GRCm39) missense possibly damaging 0.92
R9521:Mga UTSW 2 119,794,979 (GRCm39) missense probably damaging 0.99
R9780:Mga UTSW 2 119,747,253 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAGCTCCTCCATGCAACAATG -3'
(R):5'- GTGAGGAAAATACATGACTTCAACC -3'

Sequencing Primer
(F):5'- ATGCAACAATGACTTCTGTCGC -3'
(R):5'- CCTCTACATACATTCACAGAAATGAG -3'
Posted On 2014-06-30